A9JR91_DANRE

Ensembl ID:
ENSDARG00000074155
Description:
Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A9JR91]
Human Orthologues:
EPB42, TGM2, TGM3, TGM5, TGM6, TGM7
Human Descriptions:
erythrocyte membrane protein band 4.2 [Source:HGNC Symbol;Acc:3381]
transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) [Source:HGNC Symbol;
transglutaminase 3 (E polypeptide, protein-glutamine-gamma-glutamyltransferase) [Source:HGNC Symbol;
transglutaminase 5 [Source:HGNC Symbol;Acc:11781]
transglutaminase 6 [Source:HGNC Symbol;Acc:16255]
transglutaminase 7 [Source:HGNC Symbol;Acc:30790]
Mouse Orthologues:
Epb4.2, Tgm2, Tgm3, Tgm5, Tgm6, Tgm7
Mouse Descriptions:
erythrocyte protein band 4.2 Gene [Source:MGI Symbol;Acc:MGI:95402]
transglutaminase 2, C polypeptide Gene [Source:MGI Symbol;Acc:MGI:98731]
transglutaminase 3, E polypeptide Gene [Source:MGI Symbol;Acc:MGI:98732]
transglutaminase 5 Gene [Source:MGI Symbol;Acc:MGI:1921426]
transglutaminase 6 Gene [Source:MGI Symbol;Acc:MGI:3044321]
transglutaminase 7 Gene [Source:MGI Symbol;Acc:MGI:2151164]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa44381 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa44381
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109821 Essential Splice Site 77 699 3 15
Genomic Location (Zv9):
Chromosome Zv9_scaffold3522 (position 26494)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 2026859
GRCz11 6 2160525
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAACAATTGAATAATTAGTATGTGTATAATGTGTTTGTGCTGTGGTGTGC[A/C]GGTCCCCTGTCAGTGGAGGTGCCCGTCTCCTCATATGGACAGCCGTCTTC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link