si:ch211-152b13.4
- Ensembl ID:
- ENSDARG00000074137
- ZFIN ID:
- ZDB-GENE-060503-104
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B0R0L6]
- Human Orthologue:
- C2CD3
- Human Description:
- C2 calcium-dependent domain containing 3 [Source:HGNC Symbol;Acc:24564]
- Mouse Orthologue:
- C2cd3
- Mouse Description:
- C2 calcium-dependent domain containing 3 Gene [Source:MGI Symbol;Acc:MGI:2142166]
Alleles
There are 11 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa11196 |
Nonsense |
Available for shipment |
Available now |
sa35824 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa35825 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa28416 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa22599 |
Nonsense |
Available for shipment |
Available now |
sa35826 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa32023 |
Essential Splice Site |
Available for shipment |
Available now |
sa42505 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa1436 |
Nonsense |
Available for shipment |
Available now |
sa13118 |
Nonsense |
Available for shipment |
Available now |
sa35827 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa11196
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Nonsense |
95 |
2194 |
2 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14280313)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15325276 |
GRCz11 |
15 |
15261298 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATGGACACGCTGAACAGAAGGGGCTCAAATCCACAGCTCGCTTTCCTGTT[C/T]GATGTGGACCAAAACAGCTGACTTCTTATTTAACAGGTCTGATTGTTTGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35824
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Essential Splice Site |
222 |
2194 |
4 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14282355)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15327318 |
GRCz11 |
15 |
15263340 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTTGCGTGTGAAGGAGACAGATGCCAGCAGCTCTGGACACATGCCCAGG[T/C]TTGATCATTTGACTGCTGAATGAACAAAATCTAATTGAATCACTCAACTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35825
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Nonsense |
403 |
2194 |
9 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14285283)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15330246 |
GRCz11 |
15 |
15266268 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTGTGTATAGCTGTAATATGTTTTCTTATTTTAGATGTCAGATGAATGTT[T/A]GGAGGAGGACCATCATAGAAAAGGCACAACAGAGAAGCCTGTGCACACAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa28416
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Nonsense |
492 |
2194 |
11 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14286564)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15331527 |
GRCz11 |
15 |
15267549 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTGTATTAAAACTAACCTAATGCACACTTGTCCTGTTTGTCTAGTTTTTA[T/A]ATTGTAGAGTACCTCTTTCCACTGCTCTCTGCTGGGTATGAGAGTGTTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa22599
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Nonsense |
824 |
2194 |
16 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14291284)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15336247 |
GRCz11 |
15 |
15272269 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGGAGCTGCTCCTGCAGTCTCAGTATCCAGTGGTTGGAGTGGACAGTTA[T/A]ATGCCTGTGGTGGATGTATTTAGCGGCAGCACGCGAGGAAACCTCAGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35826
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Essential Splice Site |
941 |
2194 |
17 |
35 |
ENSDART00000112974 |
Essential Splice Site |
941 |
2194 |
17 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14293061)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15338024 |
GRCz11 |
15 |
15274046 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCCCAGAATGAGTCAAGAGAGGACATGGACACACATGCTGTCGAGAGCC[G/T]TAAGCTGGTTCCTTGCTCACTGTATATATATAACCTTTGATTGAGTTTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32023
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Essential Splice Site |
941 |
2194 |
17 |
35 |
ENSDART00000112974 |
Essential Splice Site |
941 |
2194 |
17 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14293061)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15338024 |
GRCz11 |
15 |
15274046 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCCCAGAATGAGTCAAGAGAGGACATGGACACACATGCTGTCGAGAGCC[G/T]TAAGCTGGTTCCTTGCTCACTGTATATATATAACCTTTGATTGAGTTTAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa42505
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Nonsense |
1534 |
2194 |
26 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14306743)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15351706 |
GRCz11 |
15 |
15287728 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTATTGCTGACCTGCAGTATCTTGTGTTTGCTGTTTTGCATGTCAGGTTG[T/A]CCTCTGGCTGAAAGAGGGGGAGGGTTGCCAAGTTGTTGTGTTTCTTATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa1436
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Nonsense |
1658 |
2194 |
28 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14308606)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15353569 |
GRCz11 |
15 |
15289591 |
- KASP Assay ID:
- 554-1363.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AAGTGTCTGTGTCTCCTCTGAGAGCAGTGCAAGAGCTGCGGGCACATAGA[C/T]AGATGGCACAGGACACTCATGCTCCAGACTCCAGTGTAAGACATTATTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13118
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Nonsense |
1923 |
2194 |
32 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14316986)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15361949 |
GRCz11 |
15 |
15297971 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CAGAAGATGAAGAAAAAAACGATCACATCTCCAGTGATGATGATGAAGAT[A/T]AAGACCAGGATGAGCATGTAGACTTTGAGGAAACTTTAATTCAKCCYAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa35827
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000112974 |
Nonsense |
2115 |
2194 |
33 |
35 |
- Genomic Location (Zv9):
- Chromosome 15 (position 14317778)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
15 |
15362741 |
GRCz11 |
15 |
15298763 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCAAATTTCTTCCTGTCAACTCACCATCTGGAGGCGTCCATGAGGGCTT[T/A]GAGGATGGCGCCTGTTTTTCCAACAGCTGAGTCTGTGAGTAATCGAACTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: