zgc:163136

Ensembl ID:
ENSDARG00000074136
ZFIN ID:
ZDB-GENE-070615-14
Description:
hypothetical protein LOC100073325 [Source:RefSeq peptide;Acc:NP_001092233]
Human Orthologues:
HERC5, HERC6
Human Descriptions:
hect domain and RLD 5 [Source:HGNC Symbol;Acc:24368]
hect domain and RLD 6 [Source:HGNC Symbol;Acc:26072]
Mouse Orthologue:
Herc6
Mouse Description:
hect domain and RLD 6 Gene [Source:MGI Symbol;Acc:MGI:1914388]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1203 Nonsense F2 line generated During 2018
sa6605 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1203
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113072 Nonsense 674 997 18 25
ENSDART00000145960 Nonsense 671 994 18 25
Genomic Location (Zv9):
Chromosome 1 (position 50041737)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48890918
GRCz11 1 49535338
KASP Assay ID:
554-1112.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AACTTGTTGCACATAAACAGGGAATCAGTGCTGACGGACACCCTTCAGTA[T/G]CTTAGACCATTTACCTACTCGTTTATGCATCCATTGCAGGTAAAACAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6605
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113072 Essential Splice Site 812 997 21 25
ENSDART00000145960 Essential Splice Site 809 994 21 25
Genomic Location (Zv9):
Chromosome 1 (position 50041082)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 48890263
GRCz11 1 49534683
KASP Assay ID:
554-4496.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGAGGAGGACGAGGANNNAGTAGTGGATTTGCAACATTTGGATTTCASGG[T/C]AATATAGTTTCTATGCAGGCCCGGATTGGATTATCAGGAGAACCGGGAGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link