
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-77o19.1
- Ensembl ID:
- ENSDARG00000074126
- ZFIN ID:
- ZDB-GENE-091116-42
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:B8JLE4]
- Human Orthologue:
- TTC39A
- Human Description:
- tetratricopeptide repeat domain 39A [Source:HGNC Symbol;Acc:18657]
- Mouse Orthologue:
- Ttc39a
- Mouse Description:
- tetratricopeptide repeat domain 39A Gene [Source:MGI Symbol;Acc:MGI:2444350]
Alleles
There are 4 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa21234 | Nonsense | Available for shipment | Available now |
sa41160 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
sa41159 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa30638 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa21234
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108659 | Nonsense | 127 | 635 | 5 | 19 |
ENSDART00000132681 | Nonsense | 163 | 222 | 6 | 9 |
ENSDART00000146469 | Nonsense | 127 | 598 | 5 | 20 |
- Genomic Location (Zv9):
- Chromosome 8 (position 17012249)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 16457137 GRCz11 8 16492849 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACATATTTGCTGCAGGAAACACAATGAAGGAGGCACAGGCTGTGTGTCAA[C/T]GGTGGGTTATATTCCGTTTCTAATAATCTTTCTTTTTGCGTATATATGAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41160
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108659 | Essential Splice Site | 142 | 635 | 6 | 19 |
ENSDART00000132681 | Essential Splice Site | 178 | 222 | 7 | 9 |
ENSDART00000146469 | Essential Splice Site | 142 | 598 | 6 | 20 |
- Genomic Location (Zv9):
- Chromosome 8 (position 17006596)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 16451484 GRCz11 8 16487196 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TACAGATACCGCAAAAAGTCTTCATTCAACAGCAAAAACTTCACCGAAGG[T/G]TGGTGCCTGTTATATTCATATTTCTCTAAATGACTGGTTGCTATTTAAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa41159
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108659 | Nonsense | 540 | 635 | 17 | 19 |
ENSDART00000132681 | None | 222 | None | 9 | |
ENSDART00000146469 | Nonsense | 503 | 598 | 18 | 20 |
- Genomic Location (Zv9):
- Chromosome 8 (position 16993523)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 16438411 GRCz11 8 16474123 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCACCACAGATGACCAGTGTGTGGTTAGTTTGCTGAAGGGCCTCTGTCTC[A/T]AACACTTGGGTTACAAGGAGGAAGCAGAACATTACTTCACCCTCGTCCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30638
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108659 | Essential Splice Site | 558 | 635 | 17 | 19 |
ENSDART00000132681 | None | 222 | None | 9 | |
ENSDART00000146469 | Essential Splice Site | 521 | 598 | 18 | 20 |
- Genomic Location (Zv9):
- Chromosome 8 (position 16993466)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 8 16438354 GRCz11 8 16474066 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGGTTACAAGGAGGAAGCAGAACATTACTTCACCCTCGTCCTCTGCAAG[T/G]CAGTCTTACGCTTTTGCTTCGCAACAAATCACACTGATATGAAAAGAAGT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: