si:dkey-4c15.5

Ensembl ID:
ENSDARG00000074125
ZFIN ID:
ZDB-GENE-050420-11
Description:
Novel proteinSi:dkey-4c15.5 protein [Source:UniProtKB/TrEMBL;Acc:A8DZC6]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa24051 Nonsense Available for shipment Available now
sa37398 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa24051
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106540 Nonsense 29 430 2 3
ENSDART00000112582   None 395 1 2
ENSDART00000133475 Nonsense 29 430 2 3
Genomic Location (Zv9):
Chromosome 22 (position 1472649)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2213739
GRCz11 22 2230005
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTGTTCTCCTGAAGCTCTGCCACCATCAGTGAAAGACAAAGACAGAGTT[T/A]ATTGAAGGACAGTGAGAAGATGAGTGATCCAGAACCCTGCAGAATTAAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37398
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106540 Nonsense 408 430 3 3
ENSDART00000112582 Nonsense 373 395 2 2
ENSDART00000133475 Nonsense 408 430 3 3
Genomic Location (Zv9):
Chromosome 22 (position 1477601)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2218691
GRCz11 22 2234957
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCACGCTGAAAGGAAAAACCACAAATGTGATCAATGCGACAAAACATTTT[T/A]GAGGGCTTCAGAGCTGAGGAAACATTTTCTAGCTCATACACAGGAGAAGC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link