
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
tgm2b
- Ensembl ID:
- ENSDARG00000074094
- ZFIN ID:
- ZDB-GENE-030131-2576
- Description:
- protein-glutamine gamma-glutamyltransferase 2 [Source:RefSeq peptide;Acc:NP_997821]
- Human Orthologue:
- TGM2
- Human Description:
- transglutaminase 2 (C polypeptide, protein-glutamine-gamma-glutamyltransferase) [Source:HGNC Symbol;
- Mouse Orthologue:
- Tgm2
- Mouse Description:
- transglutaminase 2, C polypeptide Gene [Source:MGI Symbol;Acc:MGI:98731]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa40619 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa40619
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114314 | Nonsense | 346 | 592 | 8 | 11 |
- Genomic Location (Zv9):
- Chromosome 6 (position 1951057)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 1981292 GRCz11 6 2114958 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCGAGAGCTGGATGGGTCGTTCCGATCTCCCGCCGGGTTTCGATGGCTG[G/A]CAGGCAAGTGATCCAACGCCGCAGGAGAAAAGTGAAGGTGTGCACATTTC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: