zgc:194906

Ensembl ID:
ENSDARG00000074088
ZFIN ID:
ZDB-GENE-080722-43
Description:
hypothetical protein LOC100170839 [Source:RefSeq peptide;Acc:NP_001124145]
Human Orthologue:
NLRP6
Human Description:
NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
Mouse Orthologue:
Nlrp6
Mouse Description:
NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19630 Nonsense Available for shipment Available now
sa19629 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19630
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111614 Nonsense 559 1059 4 8
Genomic Location (Zv9):
Chromosome 1 (position 59132844)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57710540
GRCz11 1 58446222
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTATTCTGGGATTTGCTCTGAGATCTTTAAGGAGGAATCTGTGATTCAG[C/T]AGAGGAAAGTCTACAGCTTCATCCATCTGAGTGTTCAGGAGTTCCTGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19629
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111614 Nonsense 602 1059 4 8
Genomic Location (Zv9):
Chromosome 1 (position 59132715)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 57710669
GRCz11 1 58446351
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACAACCATGGTGGTACTGAAGAAATTTGCTTCATTGCACAACCTACTT[A/T]AAGGTGCAGTAGATGAAGCCACTGAGAGTGAGAATGGGCATCTGGATCTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link