
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:194906
- Ensembl ID:
- ENSDARG00000074088
- ZFIN ID:
- ZDB-GENE-080722-43
- Description:
- hypothetical protein LOC100170839 [Source:RefSeq peptide;Acc:NP_001124145]
- Human Orthologue:
- NLRP6
- Human Description:
- NLR family, pyrin domain containing 6 [Source:HGNC Symbol;Acc:22944]
- Mouse Orthologue:
- Nlrp6
- Mouse Description:
- NLR family, pyrin domain containing 6 Gene [Source:MGI Symbol;Acc:MGI:2141990]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa19630 | Nonsense | Available for shipment | Available now |
sa19629 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa19630
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111614 | Nonsense | 559 | 1059 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 1 (position 59132844)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 57710540 GRCz11 1 58446222 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGTATTCTGGGATTTGCTCTGAGATCTTTAAGGAGGAATCTGTGATTCAG[C/T]AGAGGAAAGTCTACAGCTTCATCCATCTGAGTGTTCAGGAGTTCCTGGCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa19629
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000111614 | Nonsense | 602 | 1059 | 4 | 8 |
- Genomic Location (Zv9):
- Chromosome 1 (position 59132715)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 1 57710669 GRCz11 1 58446351 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ACACAACCATGGTGGTACTGAAGAAATTTGCTTCATTGCACAACCTACTT[A/T]AAGGTGCAGTAGATGAAGCCACTGAGAGTGAGAATGGGCATCTGGATCTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Platelet counts: New gene functions in megakaryopoiesis and platelet formation. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: