si:dkey-261l11.3

Ensembl ID:
ENSDARG00000074075
ZFIN ID:
ZDB-GENE-091204-21
Human Orthologue:
ANTXR1
Human Description:
anthrax toxin receptor 1 [Source:HGNC Symbol;Acc:21014]
Mouse Orthologue:
Antxr1
Mouse Description:
anthrax toxin receptor 1 Gene [Source:MGI Symbol;Acc:MGI:1916788]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31801 Essential Splice Site Available for shipment Available now
sa1032 Nonsense F2 line generated During 2018

Mutation Details

Allele Name:
sa31801
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114966 Essential Splice Site 46 645 1 18
ENSDART00000133534   None 508 None 14
ENSDART00000141450 Essential Splice Site 28 103 1 4
Genomic Location (Zv9):
Chromosome 10 (position 42340186)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41052895
GRCz11 10 40974081
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCGGATCCTCGTGCTACGGAGGCTTTGACCTCTACTTTGTGCTGGACAA[G/A]TGAGTTTCTTCTTTTATTTCTATAAGAGTGTTTGATGAAGAGAAGACGAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1032
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114966 Nonsense 404 645 15 18
ENSDART00000133534 Nonsense 315 508 11 14
ENSDART00000141450   None 103 None 4
Genomic Location (Zv9):
Chromosome 10 (position 42398692)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 41111401
GRCz11 10 41032587
KASP Assay ID:
554-0936.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAATTKTAATAAAWCAGTCTTTCTCTAAAGGACGAAGAGGACGAAGGCTA[C/A]CCGAAGAAGAAGTGGCCGACGGTGGACGCCTCRTATTACGGTGGGAGAGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Identification, replication, and fine-mapping of Loci associated with adult height in individuals of african ancestry. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link