zgc:100824

Ensembl ID:
ENSDARG00000074035
ZFIN ID:
ZDB-GENE-041114-127
Description:
Diphosphomevalonate decarboxylase [Source:UniProtKB/Swiss-Prot;Acc:Q5U403]
Human Orthologue:
MVD
Human Description:
mevalonate (diphospho) decarboxylase [Source:HGNC Symbol;Acc:7529]
Mouse Orthologue:
Mvd
Mouse Description:
mevalonate (diphospho) decarboxylase Gene [Source:MGI Symbol;Acc:MGI:2179327]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19000 Essential Splice Site Mutation detected in F1 DNA During 2018
sa21857 Nonsense Available for shipment Available now
sa21856 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa19000
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110966 Essential Splice Site 225 354 6 9
Genomic Location (Zv9):
Chromosome 11 (position 11198133)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31082385
GRCz11 18 31060639
KASP Assay ID:
2260-3977.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CAGCACATCTGGAATGCACACAAGTGTGGAGACGAGCCACCTTCTGAAGG[T/C]AAATTGTTTAATCAATTATGTTCTTATGGGATGTATTTTTGCAATATCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21857
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110966 Nonsense 296 354 7 9
Genomic Location (Zv9):
Chromosome 11 (position 11193911)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31086607
GRCz11 18 31064861
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATCGCACCAGATCATCAGTCTTGTACACCGCTACAACCAGTACTATGGC[G/T]AGACCAGGGTGAGCATAATATAACAATATTTAGAGATTTCACTAACATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21856
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110966 Nonsense 317 354 8 9
Genomic Location (Zv9):
Chromosome 11 (position 11190591)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 31089927
GRCz11 18 31068181
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TATACCTTTGATGCTGGTCCTAATGCAGTTATTTACTCCTTGCAAGACTA[C/A]TTACCAGAGTTTGTAGAGGTGGTTCGCCATTTCTTTCCCCCTAAGGTCAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link