
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-202m22.5
- Ensembl ID:
- ENSDARG00000074030
- ZFIN ID:
- ZDB-GENE-030131-3885
- Human Orthologue:
- MYT1
- Human Description:
- myelin transcription factor 1 [Source:HGNC Symbol;Acc:7622]
- Mouse Orthologue:
- Myt1
- Mouse Description:
- myelin transcription factor 1 Gene [Source:MGI Symbol;Acc:MGI:1100535]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa24368 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa24368
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114628 | Essential Splice Site | 1026 | 1156 | 18 | 21 |
ENSDART00000131285 | None | 126 | None | 6 | |
ENSDART00000135771 | Essential Splice Site | 1032 | 1162 | 20 | 23 |
ENSDART00000136156 | None | 57 | None | 6 |
- Genomic Location (Zv9):
- Chromosome 23 (position 31008919)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 23 30843809 GRCz11 23 30770340 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGGTTCCCAGGAGATGACTACATCAGCAAGAAATTCAGGGCAAGTGATG[G/A]TAAGATCAAATATCATCTGCTTCTCTTATTGTGTCCAATTATGTTTATTT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: