ZNFX1

Ensembl ID:
ENSDARG00000074028
Description:
zinc finger, NFX1-type containing 1 [Source:HGNC Symbol;Acc:29271]
Human Orthologue:
ZNFX1
Human Description:
zinc finger, NFX1-type containing 1 [Source:HGNC Symbol;Acc:29271]
Mouse Orthologue:
Znfx1
Mouse Description:
zinc finger, NFX1-type containing 1 Gene [Source:MGI Symbol;Acc:MGI:2138982]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15482 Nonsense Available for shipment Available now
sa33983 Nonsense Mutation detected in F1 DNA During 2018
sa40810 Nonsense Mutation detected in F1 DNA During 2018
sa20833 Nonsense Mutation detected in F1 DNA During 2018
sa40809 Essential Splice Site Mutation detected in F1 DNA During 2018
sa17929 Essential Splice Site Available for shipment Available now
sa40808 Nonsense Mutation detected in F1 DNA During 2018
sa40807 Missense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15482
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108597 Nonsense 179 1643 1 13
Genomic Location (Zv9):
Chromosome 6 (position 57375407)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57428469
GRCz11 6 57425333
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTTTTCTTAGCATTCTGCCACATCATGTAACTGGAAYGATGWCAGATTA[C/A]ATGCCAGCCCGAAGAGATCAGTATCCCCAGCATTTGARCAACATCATYAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33983
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108597 Nonsense 469 1643 2 13
Genomic Location (Zv9):
Chromosome 6 (position 57374448)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57427510
GRCz11 6 57424374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCCTCAGACTCATTCCTGATGGTCGAGACAACGGCTTATTTTGAGGCCTA[C/A]CGATATGTCCTAGAGGGTCTCCAGGAGCAAGATGAGAATGATGTTCCCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40810
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108597 Nonsense 707 1643 7 13
Genomic Location (Zv9):
Chromosome 6 (position 57360525)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57413587
GRCz11 6 57410451
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AACTATGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTTAGT[T/A]GAGTGATGGATTTGAGACTGTGGGGAAGAAGAAGCCTTCAATGATGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20833
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108597 Nonsense 738 1643 7 13
Genomic Location (Zv9):
Chromosome 6 (position 57360433)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57413495
GRCz11 6 57410359
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGATGGCAGAATGGCTCGGCATCGGATTCTCCTTGTTTTTTCAGGGGCCA[C/T]AACAAACAGATGGAGAAGGTGAGAGATCGTCTGTATGATTTAAAACGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40809
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108597 Essential Splice Site 1048 1643 12 13
ENSDART00000108597 Essential Splice Site 1048 1643 12 13
Genomic Location (Zv9):
Chromosome 6 (position 57353813)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57406875
GRCz11 6 57403739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTCATCTCTGGAAAACCATCCCTCTGTGCTGAAGTATGACAATGTCAAGG[T/C]AAATCAATTACGCACAAAGAACTTATGAAGATACTACTCACAGTAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17929
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108597 Essential Splice Site 1048 1643 12 13
ENSDART00000108597 Essential Splice Site 1048 1643 12 13
Genomic Location (Zv9):
Chromosome 6 (position 57353813)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57406875
GRCz11 6 57403739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTCATCTCTGGAAAACCATCCCTCTGTGCTGAAGTATGACAATGWCAAGG[T/G]AAATCAATTAMGCACAAAGAACTTATGAAGATACTACTCACAGTAATTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40808
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108597 Nonsense 1380 1643 13 13
Genomic Location (Zv9):
Chromosome 6 (position 57352726)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57405788
GRCz11 6 57402652
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGGATCACAAAAATGAGCCAAGATGTAACACCAAATGTGGTACTGTCT[T/G]AAAATGTGGCCATTCTTGTCCAGGAACGTGCAATGGATGCCATCAAGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40807
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Missense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000108597 Missense 1462 1643 13 13
Genomic Location (Zv9):
Chromosome 6 (position 57352481)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 57405543
GRCz11 6 57402407
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCAGTCTTGTGCTCCTTGCAGGGAACCCTGTGCATGGCAGTGTCCTCAT[C/A]ACAGCTGCACCAAACTGTGTCACGAACCATGTGATCGTCCACCTTGTTCT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Height: Hundreds of variants clustered in genomic loci and biological pathways affect human height. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link