wdr4

Ensembl ID:
ENSDARG00000074007
ZFIN ID:
ZDB-GENE-060810-10
Description:
tRNA (guanine-N(7)-)-methyltransferase subunit WDR4 [Source:UniProtKB/Swiss-Prot;Acc:A4IGH4]
Human Orthologue:
WDR4
Human Description:
WD repeat domain 4 [Source:HGNC Symbol;Acc:12756]
Mouse Orthologue:
Wdr4
Mouse Description:
WD repeat domain 4 Gene [Source:MGI Symbol;Acc:MGI:1889002]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa1852 Essential Splice Site F2 line generated During 2018

Mutation Details

Allele Name:
sa1852
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111634 Essential Splice Site 100 413 4 11
Genomic Location (Zv9):
Chromosome 9 (position 20523172)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 19675545
GRCz11 9 19486414
KASP Assay ID:
554-1843.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CGATCCTGTAATGCTAGTTTCTCTGAATAAGCGTATGATTGTCCWCTTGC[A/T]GGTGGGTTGTGCGGCGGTGCACTTCTCTTGCATTTACTCAAGCTGAGGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link