srpk1a

Ensembl ID:
ENSDARG00000073997
ZFIN ID:
ZDB-GENE-030131-2399
Description:
serine/arginine-rich protein specific kinase 1a [Source:RefSeq peptide;Acc:NP_955944]
Human Orthologue:
SRPK1
Human Description:
SRSF protein kinase 1 [Source:HGNC Symbol;Acc:11305]
Mouse Orthologue:
Srpk1
Mouse Description:
serine/arginine-rich protein specific kinase 1 Gene [Source:MGI Symbol;Acc:MGI:106908]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa21285 Essential Splice Site Available for shipment Available now
sa21286 Essential Splice Site Available for shipment Available now
sa9382 Nonsense Mutation detected in F1 DNA During 2018
sa21287 Essential Splice Site Available for shipment Available now
sa15574 Nonsense Available for shipment Available now
sa21288 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa21285
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Essential Splice Site 197 634 7 16
Genomic Location (Zv9):
Chromosome 8 (position 24720442)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23846260
GRCz11 8 23867499
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCAACTATCAAGGCTTACCTCTGCCCTGTGTGAAGAGCATCATTCGACAG[G/A]TAATTCAACACACCACCACACAACCAGATCAGTCTTCACCTAATTACCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21286
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Essential Splice Site 253 634 8 16
Genomic Location (Zv9):
Chromosome 8 (position 24721613)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23847431
GRCz11 8 23868670
KASP Assay ID:
2260-0565.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCCACTGAATGGCAGAAAGCAGGAGCTCCTCCTCCATCTGGATCAGCAGG[T/C]ATAGCAGTTCTGCTTTCTCACATATGACTGTGTGTCAACTTCTTCTTACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9382
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Nonsense 394 634 11 16
Genomic Location (Zv9):
Chromosome 8 (position 24723011)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23848829
GRCz11 8 23870068
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GACCACCATAACGCAAACGCAGGCCCAGAGGACACGGCTCAAAGCATGTA[T/G]GAGTACTGTAATGGGGCAGAATCCCCTGAACTTGATCAGGCCTGTTATAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21287
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Essential Splice Site 450 634 12 16
Genomic Location (Zv9):
Chromosome 8 (position 24723409)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23849227
GRCz11 8 23870466
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTAGTGAGGATGCATGGCTGTTTTTAATTGGCTCTTTTTCTGCTTGTA[G/T]ACAAGTTGTCAGCTGGAAGCCTATTGGTCAACCCACTGGATCCGCTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15574
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Nonsense 585 634 16 16
Genomic Location (Zv9):
Chromosome 8 (position 24731519)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23857337
GRCz11 8 23878576
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AATGTGTTCTCTATAGGTGACCTGAAGCACATCACCAAACTGAAGCCATG[G/A]GGTYTGCTGGACGTCCTGATGGATAAGTACGAGTGGCCTCAGGAGGAAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21288
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000037109 Nonsense 626 634 16 16
Genomic Location (Zv9):
Chromosome 8 (position 24731642)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 23857460
GRCz11 8 23878699
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CTTCCTATGCTGGAGCTCCTGCCTGAGAAAAGAGCCACGGCTTCTGACTG[T/A]CTGCGACACCCATGGCTTGCCCTCTAGTGGCTTCTCCACGCCACTGCACA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link