SLC4A7

Ensembl ID:
ENSDARG00000073952
Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 7 [Source:HGNC Symbol;Acc:11033]
Human Orthologue:
SLC4A7
Human Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 7 [Source:HGNC Symbol;Acc:11033]
Mouse Orthologue:
Slc4a7
Mouse Description:
solute carrier family 4, sodium bicarbonate cotransporter, member 7 Gene [Source:MGI Symbol;Acc:MGI:

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1291 Essential Splice Site F2 line generated During 2018
sa22928 Nonsense Available for shipment Available now
sa22927 Essential Splice Site Available for shipment Available now
sa36235 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa1291
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112879 Essential Splice Site 90 1092 3 24
Genomic Location (Zv9):
Chromosome 16 (position 45572891)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42831081
GRCz11 16 42734839
KASP Assay ID:
554-1206.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GAAAGACAGATGCTCTGAGCGAGAGGACGGCAGAGATTCACCAACGTACG[G/A]TAAGAAAAGCAGGTCATAATGGGGCTAATCTATCTGTTTTATTTGCTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22928
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112879 Nonsense 275 1092 7 24
Genomic Location (Zv9):
Chromosome 16 (position 45563697)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42821887
GRCz11 16 42725645
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGCCCCAGTCGGCCCCGGGCATCCTGGAGAACAGTAAGTCCAGTGAAAGC[C/T]GAATAAATGGCACCGGTGGCAGCAGGGAAAATAGCACAGTGGACTTCAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22927
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112879 Essential Splice Site 345 1092 8 24
Genomic Location (Zv9):
Chromosome 16 (position 45558586)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42816776
GRCz11 16 42720534
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCCTGCTGTTCTTCTCACCGGACTGACCGAAGTGCCCGTTCCGACAAG[G/A]TAGGACTACTGAAAACATGACTTGTTTACATGAATGGAGCCCCTTATAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa36235
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112879 Nonsense 497 1092 12 24
Genomic Location (Zv9):
Chromosome 16 (position 45553718)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 42811908
GRCz11 16 42715666
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTTAGCCTGCAGTGTTTGGCCTCCATCCTTTTCCTCTATTGTGCCTG[T/A]ATGTCCCCCGTCATCACCTTCGGAGGCCTTCTGGGGGAAGCCACCAAAAA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link