
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
fam59b
- Ensembl ID:
- ENSDARG00000073933
- ZFIN ID:
- ZDB-GENE-081031-49
- Human Orthologue:
- FAM59B
- Human Description:
- family with sequence similarity 59, member B [Source:HGNC Symbol;Acc:27172]
- Mouse Orthologue:
- Fam59b
- Mouse Description:
- family with sequence similarity 59, member B Gene [Source:MGI Symbol;Acc:MGI:2685290]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa29462 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa32317 | Nonsense | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa29462
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108493 | Nonsense | 167 | 810 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 48680983)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 48581075 GRCz11 20 48010797 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACTGACTCTTATGGGCCAAGCAGAACTGCTCTGCGTCCAATCAACTCGC[G/T]AGAAATCCCGCCTCACGGCGCTACTGCGCCGCCTGGGCAAAGCAGGAGGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32317
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000108493 | Nonsense | 417 | 810 | 4 | 6 |
- Genomic Location (Zv9):
- Chromosome 20 (position 48680233)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 20 48580325 GRCz11 20 48010047 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CACTCGTCGACTCGCACACGCTGCCCTCTAGTGACGGCGATGGGGAAGAG[C/T]GAGAGTACGTCACGCCTGATTGGTCGACAGAGTCGCAGGAGATTCCATAC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: