SYNRG

Ensembl ID:
ENSDARG00000073926
Description:
synergin, gamma [Source:HGNC Symbol;Acc:557]
Human Orthologue:
SYNRG
Human Description:
synergin, gamma [Source:HGNC Symbol;Acc:557]
Mouse Orthologue:
Synrg
Mouse Description:
synergin, gamma Gene [Source:MGI Symbol;Acc:MGI:1354742]

Alleles

There are 3 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa1212 Essential Splice Site F2 line generated During 2018
sa22603 Nonsense Available for shipment Available now
sa1618 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa1212
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115129 Essential Splice Site 283 1409 8 24
Genomic Location (Zv9):
Chromosome 15 (position 14975108)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 16020071
GRCz11 15 15956093
KASP Assay ID:
554-1121.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCCAAAAAAGAAAACCTAAATTCAATATGGCCTCTGTCCCAAACTGATTC[A/T]GGCCCATCTCTGGAGGAAAAGATGTTCTCATCATGTGATTTGACAGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22603
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115129 Nonsense 1197 1409 17 24
Genomic Location (Zv9):
Chromosome 15 (position 14935132)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15980095
GRCz11 15 15916117
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAACACCCTAAATGAAAAACCAGCGCTGCCGATCATCCGCGACAAGTA[C/A]AAGGACCTTACAGGAGAGGTTGAGGTCAGTTAGTCAGTCACTCTTTCTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1618
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000115129 Essential Splice Site 1342 1409 21 24
Genomic Location (Zv9):
Chromosome 15 (position 14925711)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 15970674
GRCz11 15 15906696
KASP Assay ID:
554-1559.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAGAGCTGGCGTGTGGAGTGTGCCTGCTYAATGTGGACTCACGCAGCAAG[G/A]TCTGTACACAYAAACATCTGCATATTACCATTAGTAACACACACAAAACA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link