
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:dkey-180g13.1
- Ensembl ID:
- ENSDARG00000073914
- ZFIN ID:
- ZDB-GENE-091204-96
- Human Orthologues:
- AC002321.1, FAM163B
- Human Descriptions:
- family with sequence similarity 163, member B [Source:HGNC Symbol;Acc:33277]
- Uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:A8MTS3]
- Mouse Orthologue:
- Fam163b
- Mouse Description:
- family with sequence similarity 163, member B Gene [Source:MGI Symbol;Acc:MGI:1926106]
Alleles
There is 1 allele of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa38781 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa38781
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000112135 | Nonsense | 33 | 169 | 2 | 3 |
ENSDART00000136853 | Nonsense | 33 | 185 | 3 | 3 |
- Genomic Location (Zv9):
- Chromosome 10 (position 10666206)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 10 10742072 GRCz11 10 10700310 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTACAAAATATAATTCTCACACGCTCTCTCCTTGCTTCCATCTAGTACTA[T/A]TGCTGTAAGAAGGAGGAGTCGGAGTCAGAGGAGGAGGAGCCTGACTTCGC
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: