VWA5A (4 of 4)

Ensembl ID:
ENSDARG00000073905
Description:
von Willebrand factor A domain containing 5A [Source:HGNC Symbol;Acc:6658]
Human Orthologue:
VWA5A
Human Description:
von Willebrand factor A domain containing 5A [Source:HGNC Symbol;Acc:6658]
Mouse Orthologues:
AW551984, Vwa5a
Mouse Descriptions:
expressed sequence AW551984 Gene [Source:MGI Symbol;Acc:MGI:2143322]
von Willebrand factor A domain containing 5A Gene [Source:MGI Symbol;Acc:MGI:1915026]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa6785 Essential Splice Site Mutation detected in F1 DNA During 2018
sa30169 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa6785
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004689 Essential Splice Site 522 804 12 25
Genomic Location (Zv9):
Chromosome 25 (position 302147)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 233781
GRCz11 25 256534
KASP Assay ID:
554-4916.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTGAGGTTCAGCTGGTCAACGCTATAGAAGAGAGTTTGAAGAATGCTGG[C/T]GYCCGTCCATATGATGCTGTGGAAGTGGATGGTGAACCAGCATTCTTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30169
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000004689 Essential Splice Site 692 804 22 25
Genomic Location (Zv9):
Chromosome 25 (position 305134)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 236768
GRCz11 25 259521
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCGTCTGCCCCCGTCGTCCTGATGGAGTGTGATTCTGCATCCGCTCAAGG[T/A]ATTCAGTCGTGTGTGTGTGTGTGTGTGTGTGTGTACTTCAGCTGTGTTGA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link