
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
cx47.1
- Ensembl ID:
- ENSDARG00000073896
- ZFIN ID:
- ZDB-GENE-040912-134
- Description:
- connexin 47.1 [Source:RefSeq peptide;Acc:NP_001004574]
- Human Orthologue:
- GJC2
- Human Description:
- gap junction protein, gamma 2, 47kDa [Source:HGNC Symbol;Acc:17494]
- Mouse Orthologue:
- Gjc2
- Mouse Description:
- gap junction protein, gamma 2 Gene [Source:MGI Symbol;Acc:MGI:2153060]
Alleles
There are 5 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25746 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa11554 | Nonsense | Available for shipment | Available now |
sa39750 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa540 | Nonsense | F2 line generated | During 2018 |
sa32830 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25746
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115278 | Nonsense | 123 | 409 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 3991208)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 3665734 GRCz11 2 3496913 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACGACACAAGAACCAGATTTACCAGAAGAGGAGGCACCACAGTCGCTGG[A/T]GAAACGGACACCATCTAGAGGACGCTTTAGAGGAGGAAGATGAGGACGCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa11554
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115278 | Nonsense | 177 | 409 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 3991372)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 3665898 GRCz11 2 3497077 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AAACACGATGGCCGCCGCAGGATCATGCAAGAAGGTTTAATGAGGATGTA[T/A]GTWCTTCAACTTTTATCYCGCGCCATCTTYGAGGTGGGATTCCTCAYGGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa39750
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115278 | Nonsense | 236 | 409 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 3991549)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 3666075 GRCz11 2 3497254 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCTTTGTTTCAAGACCCACCGAGAAGACCATCTTTTTGCTCATCATGTA[T/A]GTGGTGAGCTGTCTATGTCTGCTGCTCAATGTTTGCGAGATGTTTCACTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa540
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115278 | Nonsense | 310 | 409 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 3991769)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 3666295 GRCz11 2 3497474 - KASP Assay ID:
- 554-0450.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- TTAAATCCGACAAACCCGGTCGCATTCCCAACAGCATCGTCCTGCCTGAT[C/T]AGAACATGGATAGAGAGATCGCAGAACAACACTGCACAAGTCCTGATGAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa32830
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000115278 | Nonsense | 340 | 409 | 2 | 2 |
- Genomic Location (Zv9):
- Chromosome 2 (position 3991859)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 2 3666385 GRCz11 2 3497564 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GTCCTGATGAGAACATCCCCACTGACCTAGCAACCTTGCACCACCATTTA[C/T]GAGTAGCTCAGGAGCAGCTTGACATGGCTTTTCAGACATACAACACAAAA
- Associated Phenotype:
- Not determined
OMIM
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: