si:dkey-31j3.9

Ensembl ID:
ENSDARG00000073870
ZFIN ID:
ZDB-GENE-081107-62
Human Orthologue:
GDPD2
Human Description:
glycerophosphodiester phosphodiesterase domain containing 2 [Source:HGNC Symbol;Acc:25974]
Mouse Orthologue:
Gdpd2
Mouse Description:
glycerophosphodiester phosphodiesterase domain containing 2 Gene [Source:MGI Symbol;Acc:MGI:1918834]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa22513 Nonsense Available for shipment Available now
sa39007 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa22513
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111397 Nonsense 72 514 3 15
ENSDART00000147038   None 361 1 11

The following transcripts of ENSDARG00000073870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34222493)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32907193
GRCz11 14 33247507
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTCTTCTGCAGTGAACTCTTCAAAGCAGTGAAAAAATGGGTGAACTG[G/A]TACATGATAGTGATGATCATTTCAGCTGTGCTTGCCATATACTGCTTGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39007
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000111397 Essential Splice Site 375 514 10 15
ENSDART00000147038 Essential Splice Site 213 361 7 11

The following transcripts of ENSDARG00000073870 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 34212897)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 32897597
GRCz11 14 33237911
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CCTTCTACACCACTGAAACGATCAATAAATTAGGCATCTCACCTGACAAG[G/A]TAATACTGACATTTTTATGACAGCTAGTTCCATTCTTTAATACTGATTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link