herc2
- Ensembl ID:
- ENSDARG00000073841
- ZFIN ID:
- ZDB-GENE-070718-6
- Human Orthologue:
- HERC2
- Human Description:
- hect domain and RLD 2 [Source:HGNC Symbol;Acc:4868]
- Mouse Orthologue:
- Herc2
- Mouse Description:
- hect (homologous to the E6-AP (UBE3A) carboxyl terminus) domain and RCC1 (CHC1)-like domain (RLD) 2
Alleles
There are 16 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa40738 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa15868 |
Nonsense |
Available for shipment |
Available now |
sa44640 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa13507 |
Nonsense |
Available for shipment |
Available now |
sa30874 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa13593 |
Nonsense |
Available for shipment |
Available now |
sa13641 |
Nonsense |
Available for shipment |
Available now |
sa40739 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa33904 |
Nonsense |
Available for shipment |
Available now |
sa33905 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa33906 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa38562 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa20751 |
Essential Splice Site |
Available for shipment |
Available now |
sa10421 |
Essential Splice Site |
Available for shipment |
Available now |
sa20752 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa20753 |
Nonsense |
Available for shipment |
Available now |
Mutation Details
- Allele Name:
- sa40738
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
273 |
4832 |
7 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37720324)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37794082 |
GRCz11 |
6 |
37771976 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAGTGACATCCATGGAAGTGCCAGTGGAAAAGCACCCAGTAACATTCCCT[T/A]GCAGGATCAGCACTTGGCCCTTGCCATCCTGCTGGAGCTCGCAGTGCAAC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15868
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
667 |
4832 |
14 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37727770)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37801528 |
GRCz11 |
6 |
37779422 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TGAAGGTGTGCTGTGGGAGCCAGTTCTCCGTAGCGCTCACTAAAGATGGA[C/T]ARGTTTACACCTGGGGCAAAGGAGACAATCAACGACTTGGACATGGCACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa44640
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
894 |
4832 |
17 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37732757)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37806117 |
GRCz11 |
6 |
37784011 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGACCGTGCTCCAGAGTGGCTGGTCAGTGCTACTCCCCACTGCAGAGGAA[C/T]GAGCAAGAGCCCTGTCCTCGCTGCTGCCCAATGCAGGTCAGTGCATGAAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13507
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
1088 |
4832 |
21 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37736814)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37810174 |
GRCz11 |
6 |
37788068 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TCACTCAGARATTCWGGGAGTTGGCTCTCTCYTGAAGAAGTATATGGCTT[T/A]GCKTTGCACACACATCGGTGATATCCTTCCTGTGGCCACCAGCATTGCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30874
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
1166 |
4832 |
22 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37737471)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37810831 |
GRCz11 |
6 |
37788725 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCCATTCCTCTGCTCGCTGCTCTTCTGGAGCACTTGGACCGTTTTAACTA[T/G]CTTGCACCTGGTACAGAAAGAGATGACAATGAGGATCTTGCCTGGCCTGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13593
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 37740398)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37813758 |
GRCz11 |
6 |
37791700 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AATGCATGTNAAAAAAAAAGTCACTTGCTYCTATACCTYCCAGAATGGCTC[C/T]AGTCATCYATTTTCTTYGGTGGACTTCAGACCAGTCAGATCCACTATAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13641
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
- Genomic Location (Zv9):
- Chromosome 6 (position 37740398)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37813758 |
GRCz11 |
6 |
37791700 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AATGCATGTNAAAAAAAAAGTCACTTGCTYCTATACCTYCCAGAATGGCTC[C/T]AGTCATCYATTTTCTTYGGTGGACTTCAGACCAGTCAGATCCACTATAAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40739
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Essential Splice Site |
1399 |
4832 |
26 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37740606)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37813966 |
GRCz11 |
6 |
37791908 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CTTCCTGCAGGCCATCGCTGACAACACCACCCAGGATCACACTGTGAAGG[T/G]CACAGCATTTATTTGTCTCCTCATTTAATATTATGTATAATACAGATTTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33904
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
1463 |
4832 |
28 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37741232)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37814592 |
GRCz11 |
6 |
37792534 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TCGCCCTCTCCCTAGTTGATCAATGTGCCTTGGGTATGGACCAGGGGAAA[C/T]AGAGGTCCCTCCCGAAATCTGTGATTGATGTGTGTCGAATGGTGTATCAG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33905
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Essential Splice Site |
1595 |
4832 |
30 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37742438)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37815798 |
GRCz11 |
6 |
37793734 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TAAGCCCCGCTCCTGTTGACAAGAAGCAAACAACTGTCAAATCTGCAAAG[G/T]TTTGCCACTTTCTATTTACGTTAATTTTTTAAGTCACTGTCCTTTTAGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa33906
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
2185 |
4832 |
41 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37751571)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37824931 |
GRCz11 |
6 |
37802867 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGGTTAGTTCTCCTATGCTGTTTTTTCTGTCAGGCTTTGCTTGAAGACTA[T/A]CTCCCCAATGCGGAAGCAGCAGCGGTGGGCAGTCTGATGGCTGTTTTGGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa38562
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Essential Splice Site |
2303 |
4832 |
42 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37752254)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37825614 |
GRCz11 |
6 |
37803550 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAGCTGGAGAAACAACGCATGAAGAAATCTCTTAGTAGAGGACTTACAGG[T/C]ACAGCACATGCACAGATCCATAGAAAAACACATATTTGTTCACTTGATCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20751
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Essential Splice Site |
2535 |
4832 |
46 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37757566)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37830926 |
GRCz11 |
6 |
37808862 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGAAGAGGTGCTGGAAGAGCTTGAGGAGCCTGAGCCTGCCTTTCCTGTGG[T/A]ACATACAAATACACTGATCACACAATCCAGATGTGAGGTGCTGATTCACT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10421
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > C
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Essential Splice Site |
2625 |
4832 |
48 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37758769)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37832129 |
GRCz11 |
6 |
37810065 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CAGAAAGGAGGAACYTACTGGGTCCGTTACATCCACACTGAGCTGCTGGG[T/C]AATACTCTTTMTGTTCTCTTAMACATTTTTATAGGTATTTGTTAATTGAA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20752
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
3466 |
4832 |
66 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37771813)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37845173 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CCTCAGAGAGTGAGGAGAGGGTCAGTCCGCACCCCTGGATGGACAGCAAA[C/T]GAGGAGAGGTGAGGAGTTCTGCCAATTCTTGACTGTGTGTGTGTATGTAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa20753
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000110770 |
Nonsense |
4262 |
4832 |
82 |
93 |
- Genomic Location (Zv9):
- Chromosome 6 (position 37784148)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
6 |
37857508 |
GRCz11 |
6 |
37834714 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGCAAAAAGGTCATCGCAATAGCAACTGGTTCCCTTCACTGCGTTTGCTG[C/A]ACGGAGGACGGTAGGTCATTAGTATGTTTGAATTATGCTGGCCTTTGTCA
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following
GWAS studies:
- Black vs. red hair color: A genome-wide association study identifies novel alleles associated with hair color and skin pigmentation. (View Study)
- Eye color: Genome-wide association studies of quantitatively measured skin, hair, and eye pigmentation in four European populations. (View Study)
- Eye color traits: Digital quantification of human eye color highlights genetic association of three new loci. (View Study)
- Iris color: Three genome-wide association studies and a linkage analysis identify HERC2 as a human iris color gene. (View Study)
- Vitiligo: Genome-wide association analyses identify 13 new susceptibility loci for generalized vitiligo. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: