
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
rasgrf1
- Ensembl ID:
- ENSDARG00000073824
- Human Orthologue:
- RASGRF1
- Human Description:
- Ras protein-specific guanine nucleotide-releasing factor 1 [Source:HGNC Symbol;Acc:9875]
- Mouse Orthologue:
- Rasgrf1
- Mouse Description:
- RAS protein-specific guanine nucleotide-releasing factor 1 Gene [Source:MGI Symbol;Acc:MGI:99694]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa45639 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa45640 | Essential Splice Site | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa45639
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109257 | Nonsense | 61 | 1256 | 1 | 27 |
- Genomic Location (Zv9):
- Chromosome 18 (position 26124913)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 26353906 GRCz11 18 26338424 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTGCTCTGTTGCAAAATATGCTTTTTTATTTTGAGAGCGAGTCCAGCTCG[C/T]GACCCTCGGGATTATACCTGTTGGAGGGATGTGTGTGTGACAGGTCGCCC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45640
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000109257 | Essential Splice Site | 1008 | 1256 | 20 | 27 |
- Genomic Location (Zv9):
- Chromosome 18 (position 26198546)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 18 26427539 GRCz11 18 26412057 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AGAGGATCCTGGTGATAATCAGATCTGTCTGGAGGAGGTTCTGCAGATGG[T/A]GAGTGTGGTGCTTCTTGATCATCCTCCAGCATATTAAACATTTTTCAGTG
- Associated Phenotype:
- Not determined
GWAS
This gene's human homologue has been identified in the following GWAS studies:
- Refractive error: A genome-wide association study for myopia and refractive error identifies a susceptibility locus at 15q25. (View Study)
- Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
- RR interval (heart rate): A genome-wide association scan of RR and QT interval duration in 3 European genetically isolated populations: the EUROSPAN project. (View Study)
(GWAS data comes from http://www.genome.gov/gwastudies/.)
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: