rasgrf1

Ensembl ID:
ENSDARG00000073824
Human Orthologue:
RASGRF1
Human Description:
Ras protein-specific guanine nucleotide-releasing factor 1 [Source:HGNC Symbol;Acc:9875]
Mouse Orthologue:
Rasgrf1
Mouse Description:
RAS protein-specific guanine nucleotide-releasing factor 1 Gene [Source:MGI Symbol;Acc:MGI:99694]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45639 Nonsense Mutation detected in F1 DNA During 2018
sa45640 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45639
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109257 Nonsense 61 1256 1 27
Genomic Location (Zv9):
Chromosome 18 (position 26124913)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26353906
GRCz11 18 26338424
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGCTCTGTTGCAAAATATGCTTTTTTATTTTGAGAGCGAGTCCAGCTCG[C/T]GACCCTCGGGATTATACCTGTTGGAGGGATGTGTGTGTGACAGGTCGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45640
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109257 Essential Splice Site 1008 1256 20 27
Genomic Location (Zv9):
Chromosome 18 (position 26198546)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 26427539
GRCz11 18 26412057
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGAGGATCCTGGTGATAATCAGATCTGTCTGGAGGAGGTTCTGCAGATGG[T/A]GAGTGTGGTGCTTCTTGATCATCCTCCAGCATATTAAACATTTTTCAGTG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

  • Refractive error: A genome-wide association study for myopia and refractive error identifies a susceptibility locus at 15q25. (View Study)
  • Refractive error: Genome-wide meta-analyses of multiancestry cohorts identify multiple new susceptibility loci for refractive error and myopia. (View Study)
  • RR interval (heart rate): A genome-wide association scan of RR and QT interval duration in 3 European genetically isolated populations: the EUROSPAN project. (View Study)

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link