zgc:174917

Ensembl ID:
ENSDARG00000073820
ZFIN ID:
ZDB-GENE-070928-42
Description:
hypothetical protein LOC565650 [Source:RefSeq peptide;Acc:NP_001099060]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa30978 Nonsense Mutation detected in F1 DNA During 2018
sa42358 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa30978
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109181 Nonsense 42 280 3 8
ENSDART00000109181 Nonsense 42 280 3 8
Genomic Location (Zv9):
Chromosome 14 (position 11705191)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11200548
GRCz11 14 11506562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAGAGGAGCTGCAACAGGCCCGCAATGCTTTTGCTGAGCTGGAGAGA[A/T]AACATGGTGAGCTTCAGTGAAACTGAATTTGAATTTTAGGACAGGTTTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42358
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109181 Nonsense 42 280 3 8
ENSDART00000109181 Nonsense 42 280 3 8
Genomic Location (Zv9):
Chromosome 14 (position 11705191)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11200548
GRCz11 14 11506562
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCCAGAGGAGCTGCAACAGGCCCGCAATGCTTTTGCTGAGCTGGAGAGA[A/T]AACATGGTGAGCTTCAGTGAAACTGAATTTGAATTTTAGGACAGGTTTGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link