
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
scly
- Ensembl ID:
- ENSDARG00000073813
- ZFIN IDs:
- ZDB-GENE-080204-30, ZDB-GENE-080204-30
- Description:
- selenocysteine lyase [Source:RefSeq peptide;Acc:NP_001103853]
- Human Orthologue:
- SCLY
- Human Description:
- selenocysteine lyase [Source:HGNC Symbol;Acc:18161]
- Mouse Orthologue:
- Scly
- Mouse Description:
- selenocysteine lyase Gene [Source:MGI Symbol;Acc:MGI:1355310]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa2295 | Nonsense | F2 line generated | During 2018 |
sa10972 | Essential Splice Site | Available for shipment | Available now |
Mutation Details
- Allele Name:
- sa2295
- Current Status:
-
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113596 | Nonsense | 41 | 450 | 2 | 12 |
ENSDART00000114347 | Nonsense | 41 | 450 | 3 | 13 |
- Genomic Location (Zv9):
- Chromosome 6 (position 26984921)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 27286132 GRCz11 6 27276693 - KASP Assay ID:
- 554-2667.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- AGAATGCAATTAATCGAATAACTGTTTTRCTGCAGAATATATATGGATTA[C/A]AACGCCACCACACCAGCCGATCCAGAGGTGATCAGGGTTGTTACTGATGC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10972
- Current Status:
-
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
-
Order Allele From ZIRC
Order Allele From EZRC - Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000113596 | Essential Splice Site | 106 | 450 | 3 | 12 |
ENSDART00000114347 | Essential Splice Site | 106 | 450 | 4 | 13 |
- Genomic Location (Zv9):
- Chromosome 6 (position 26986314)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 6 27287525 GRCz11 6 27278086 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- GGTCGGTGGAAAAGCAGCAGACATTATTTTTACTTCAGGAGGAACTGAGG[T/G]GAGTCATGAAAATGAGCTTGTTTTTTNTTGTTGTAAAAGATAAAATASAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: