wu:fi34b01

Ensembl ID:
ENSDARG00000073811
ZFIN ID:
ZDB-GENE-030131-6091

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa32846 Nonsense Available for shipment Available now
sa16112 Nonsense Available for shipment Available now
sa10268 Nonsense Available for shipment Available now
sa19679 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa32846
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112995 Nonsense 291 429 1 1
Genomic Location (Zv9):
Chromosome 2 (position 9314833)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9849734
GRCz11 2 9647739
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTATTATGGTAAGCCAAACCCTGTCAACAAACCAGTCTCATCAGTTGCC[C/T]AAACACCAATTCAGTATCCTCAACTGCCAGTATACCCCCAGATCGATTGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16112
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112995 Nonsense 307 429 1 1
Genomic Location (Zv9):
Chromosome 2 (position 9314883)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9849684
GRCz11 2 9647689
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CAAACACCAATYCAGTWTCCTCAACTGCCAGTATACCCCCAGATCGATTG[G/A]TCGTAKTACTATAATCGTGGCAAACCGAAGACACCAGTTTCTGCTTCAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10268
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112995 Nonsense 309 429 1 1
Genomic Location (Zv9):
Chromosome 2 (position 9314889)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9849678
GRCz11 2 9647683
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CCAATYCAGTWTCCTCAACTGCCAGTATACCCCCAGATCGATTGGTCGTA[T/G]TACTATAATCGTGGCAAACCGAAGACACCAGYTTCTGCTTCAATTCCCGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19679
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112995 Nonsense 336 429 1 1
Genomic Location (Zv9):
Chromosome 2 (position 9314970)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9849597
GRCz11 2 9647602
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTTTCTGCTTCAATTCCCGACACCCCAGCAGTACCCCAACCACCACCCTA[T/A]AAGCCTCAACCTCAGTACCCCCAGATGTTTTGGCAATATTATCCTAATTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link