cntnap5
- Ensembl ID:
- ENSDARG00000073802
- Human Orthologue:
- CNTNAP5
- Human Description:
- contactin associated protein-like 5 [Source:HGNC Symbol;Acc:18748]
- Mouse Orthologues:
- Cntnap5a, Cntnap5b, Cntnap5c
- Mouse Descriptions:
- contactin associated protein-like 5A Gene [Source:MGI Symbol;Acc:MGI:3643623]
- contactin associated protein-like 5B Gene [Source:MGI Symbol;Acc:MGI:3664583]
- contactin associated protein-like 5C Gene [Source:MGI Symbol;Acc:MGI:3646013]
Alleles
There are 8 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa13748 |
Nonsense |
Available for shipment |
Available now |
sa21940 |
Essential Splice Site |
Available for shipment |
Available now |
sa45432 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa8838 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa21941 |
Essential Splice Site |
Available for shipment |
Available now |
sa13789 |
Essential Splice Site |
Available for shipment |
Available now |
sa14172 |
Essential Splice Site |
Available for shipment |
Available now |
sa9104 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa13748
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111193 |
Nonsense |
80 |
1310 |
3 |
24 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34313838)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
33214775 |
GRCz11 |
11 |
33477577 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAGGAGGTGGGGGGTGGTCTCCRAGCGGAGAAGACCAGCAMCCTTGGCTT[C/T]AGCTGGACCTACGGGAYAGGTTGAAGGTCACATCCATTGCCACCCAGGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21940
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- A > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111193 |
Essential Splice Site |
246 |
1310 |
6 |
24 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34347148)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
33248085 |
GRCz11 |
11 |
33510887 |
- KASP Assay ID:
- 2260-4486.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATGTTTGCTTATGTTGTCCAGTCTATGTTTCTAGTGTCTTTCTCTGTAC[A/T]GATGATGCCAAGCCCCAGTCTGGTGGTCGCTCATCATCTGTCATGTTAGG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa45432
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111193 |
Nonsense |
336 |
1310 |
7 |
24 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34350993)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
33251930 |
GRCz11 |
11 |
33514732 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- GGGACGTTTCTTCATGAAAATTTCCATGGCTGCATAGAGAACCTCAACTA[C/A]AACGGCGTCAATGTCATCGACATGGCAAAGAGACGAAAGCCACAGATTTA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa8838
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111193 |
Nonsense |
348 |
1310 |
7 |
24 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34351027)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
33251964 |
GRCz11 |
11 |
33514766 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TAGAGAAYCTCAACTACAACGGCGTCAATGTCATCGACATGGCAAAGMGA[C/T]GAAAGCCACAGATTTATACCGTGGTAAGTTTGAANNNGAACAATCGCAWT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa21941
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111193 |
Essential Splice Site |
495 |
1310 |
9 |
24 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34357764)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
33258701 |
GRCz11 |
11 |
33521503 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AATCACTGGACGTAGCCAAACCCCCCAGAGAACAACCATCTACATTGGAG[G/A]TACAGCATTAGAAATGCAAAAAGTCAGTTTATTCTTACTAGCTGTATTCA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa13789
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111193 |
Essential Splice Site |
553 |
1310 |
10 |
24 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34358554)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
33259491 |
GRCz11 |
11 |
33522293 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- ATGGGCAACTTTAGCCAGATTAGCTTTGATGTTTGCAACATACAAGWTAG[G/A]TCTGTTTCMCTGTGTGTGCNNGTGTGTGTGTCTGTGTTTATGTGAATCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa14172
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > T
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111193 |
Essential Splice Site |
921 |
1310 |
18 |
24 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34373505)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
33274442 |
GRCz11 |
11 |
33537244 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- CTTGGCTTTGTAAATTGCCRAGACAAYTAATCATTGTAATCTCCCCATTA[G/T]GAGGAACGGCTTCAAGGCAGAGGGGCTTCGTGGGCTGCTTACGCGCKCTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9104
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000111193 |
Nonsense |
1025 |
1310 |
19 |
24 |
- Genomic Location (Zv9):
- Chromosome 11 (position 34375845)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
11 |
33276782 |
GRCz11 |
11 |
33539584 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGTCTTCAGTCCTGTATACTCTCCAKGAGCCATTTTCTGGGATACTAAAC[G/T]AGGAAGCCAGAAGWWCGCCGGCTGGTTTCCATGATGCAGAAGTTGCCAAG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: