si:dkeyp-104h9.5

Ensembl ID:
ENSDARG00000073801
ZFIN ID:
ZDB-GENE-081104-449
Description:
hypothetical protein LOC568307 [Source:RefSeq peptide;Acc:NP_001107084]
Human Orthologue:
KIAA2013
Human Description:
KIAA2013 [Source:HGNC Symbol;Acc:28513]
Mouse Orthologue:
2510039O18Rik
Mouse Description:
RIKEN cDNA 2510039O18 gene Gene [Source:MGI Symbol;Acc:MGI:1924284]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa13387 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13387
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110393 Nonsense 335 620 2 3
ENSDART00000145429 Nonsense 321 606 2 3
Genomic Location (Zv9):
Chromosome 8 (position 49994748)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 47846725
GRCz11 8 47835717
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TAGGCTTTCTAATATGAGTTTACTTTGATTCTTTTTCAGGTGTGGAAATC[C/T]GAAAGATCACAGATGCCCACACTCCGTCCAGTCGAACAGTCAACAACACC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link