zgc:194210

Ensembl ID:
ENSDARG00000073799
ZFIN ID:
ZDB-GENE-030131-2476
Description:
hypothetical protein LOC794982 [Source:RefSeq peptide;Acc:NP_001124081]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa36178 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36178
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113437 Nonsense 112 335 9 14
ENSDART00000138508 Nonsense 125 348 9 14

The following transcripts of ENSDARG00000073799 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 16 (position 33736480)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 31474380
GRCz11 16 31432307
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATGTACATATTTAGAATTTCTTAATTTCATGTTAAAACAGACAGCAGAT[T/A]ACCTGAAAGAGCATCAACTGAAGACAGCAGAGGTATACTGATTTATTAAA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link