
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
si:ch211-181b18.1
- Ensembl ID:
- ENSDARG00000073792
- ZFIN ID:
- ZDB-GENE-091116-34
- Human Orthologue:
- MAN1B1
- Human Description:
- mannosidase, alpha, class 1B, member 1 [Source:HGNC Symbol;Acc:6823]
- Mouse Orthologue:
- Man1b1
- Mouse Description:
- mannosidase, alpha, class 1B, member 1 Gene [Source:MGI Symbol;Acc:MGI:2684954]
Alleles
There are 3 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa43604 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa37256 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa31055 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa43604
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114715 | Nonsense | 138 | 682 | 4 | 14 |
- Genomic Location (Zv9):
- Chromosome 21 (position 12442016)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 14143190 GRCz11 21 14239919 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AACCAGATGTTATGCCAGAGCTTCAGAAACCCAGCATTCCATTACTTCCT[A/T]AACCTCCAGCTATGGTTAGTGGAAATGCATAATTCACTGTTATACAGTTG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa37256
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114715 | Nonsense | 227 | 682 | 7 | 14 |
- Genomic Location (Zv9):
- Chromosome 21 (position 12434755)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 14135929 GRCz11 21 14232658 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- ATCTTAAAGCTCTAATCTTAAAGTGTTTTATTTGTGATGCTCAGGGACAT[T/A]GAAGCCAGTGGATCGTGTGGAAGCGGTGCAGGAGGCCTTCAGGCATGCAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31055
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000114715 | Nonsense | 449 | 682 | 10 | 14 |
- Genomic Location (Zv9):
- Chromosome 21 (position 12428653)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 21 14129827 GRCz11 21 14226556 - KASP Assay ID:
- None (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCACGCGGCGAGGGGCCTTTACCCTGGGGGCCCGAGCAGACAGTTACTA[C/A]GAGTACCTGCTCAAACAGTGGCTTCAGGGCGGCAAGAAGGAGACTGAGTG
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: