si:dkey-31e3.5

Ensembl ID:
ENSDARG00000073757
ZFIN ID:
ZDB-GENE-090313-307
Human Orthologue:
PDZRN3
Human Description:
PDZ domain containing ring finger 3 [Source:HGNC Symbol;Acc:17704]
Mouse Orthologue:
Pdzrn3
Mouse Description:
PDZ domain containing RING finger 3 Gene [Source:MGI Symbol;Acc:MGI:1933157]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa45790 Nonsense Mutation detected in F1 DNA During 2018
sa43923 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa45790
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112965 Nonsense 52 1033 1 10
ENSDART00000142533   None 87 None 3
Genomic Location (Zv9):
Chromosome 23 (position 11020348)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10979150
GRCz11 23 10914120
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTTCTGCGCCGCGTGCGCGCTCCAGTGGCTCTCCAAAGTCAACAGCTG[T/A]CCCGTCCAATGCCAGAAGATATCCAACAAAGAGCTGAACCAAGTCCTACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43923
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000112965 Nonsense 130 1033 1 10
ENSDART00000142533   None 87 None 3
Genomic Location (Zv9):
Chromosome 23 (position 11020116)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 10978918
GRCz11 23 10913888
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGAAGGATGCGACGCGGTGCTCAACCTGAAGGACGCGGCCTCACACCTG[C/T]AGGAGACGTGCGAGTACAGGGCGCTGGAGGTCTGTAAGAATGGATGTGGG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link