slc12a7a

Ensembl ID:
ENSDARG00000073756
ZFIN ID:
ZDB-GENE-070912-696
Description:
Novel protein similar to vertebrate solute carrier family 12, (Potassium-chloride transporter) [Sour
Human Orthologue:
SLC12A7
Human Description:
solute carrier family 12 (potassium/chloride transporters), member 7 [Source:HGNC Symbol;Acc:10915]
Mouse Orthologue:
Slc12a7
Mouse Description:
solute carrier family 12, member 7 Gene [Source:MGI Symbol;Acc:MGI:1342283]

Alleles

There are 7 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa39822 Nonsense Mutation detected in F1 DNA During 2018
sa6840 Essential Splice Site Mutation detected in F1 DNA During 2018
sa45099 Nonsense Mutation detected in F1 DNA During 2018
sa38330 Essential Splice Site Mutation detected in F1 DNA During 2018
sa11119 Essential Splice Site Available for shipment Available now
sa31278 Nonsense Available for shipment Available now
sa19756 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa39822
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089234 Nonsense 259 1088 7 26
Genomic Location (Zv9):
Chromosome 2 (position 23813207)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24395288
GRCz11 2 24050939
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCCTTGGTCTTCCTGTCCTGTGTGGTGCTGTCAATTATGGCCATTTA[T/A]GCAGGAGTCATTCAGTCAGCCATCAAACCATCCAGTTTTACGTGAGTAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6840
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089234 Essential Splice Site 399 1088 9 26
Genomic Location (Zv9):
Chromosome 2 (position 23815326)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24393169
GRCz11 2 24048820
KASP Assay ID:
554-4761.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCCACCTTCTTCACCCTCCTGGTTGGAATCTACTTTCCCTCAGTTACAGG[T/C]ACTATATYCTTCCTTAGTCTGACTTTGAATAGGTTACTGCAAAAAGAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45099
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089234 Nonsense 620 1088 15 26
Genomic Location (Zv9):
Chromosome 2 (position 23818579)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24389916
GRCz11 2 24045567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCTTTGGTTGTCATATTGATTGCCGGATGCATCTATAAATACATCGAATA[C/A]AGAGGGTAAGCAAGTATCCATCAAATCCAAAAATGCTGGCTTTTCATAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38330
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089234 Essential Splice Site 622 1088 15 26
Genomic Location (Zv9):
Chromosome 2 (position 23818586)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24389909
GRCz11 2 24045560
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGTCATATTGATTGCCGGATGCATCTATAAATACATCGAATACAGAGGG[T/C]AAGCAAGTATCCATCAAATCCAAAAATGCTGGCTTTTCATAACCCTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11119
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089234 Essential Splice Site 622 1088 16 26
Genomic Location (Zv9):
Chromosome 2 (position 23818753)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24389742
GRCz11 2 24045393
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TACCTTAAGCTTAGRGATTATTCCTAACGGTTTTATTTCSTCTCCCCTCA[G/T]GGCAGTGAAGGAATGGGGAGATGGTCTTCGAGGATTATCTCTCAATGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31278
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089234 Nonsense 936 1088 22 26
Genomic Location (Zv9):
Chromosome 2 (position 23826803)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24381692
GRCz11 2 24037343
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCAGATGAATCCCGGATTTCCATCAGGAGGAAGCCCTGTGGGGAGAAA[C/T]AAACTCACAACAGCAAATTAAAAGTGGCAACTGTAAATCTGGACGAGGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19756
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089234 Nonsense 982 1088 23 26
Genomic Location (Zv9):
Chromosome 2 (position 23830153)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 24378342
GRCz11 2 24033993
KASP Assay ID:
2259-1991.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGTTGAAAAGGCCACACCCACTTCTGACCGGGTCCATATGACCTG[G/A]ACCAAAGAAAAGCTGATTGGAGAGAGAAATCGTCTTCGGGATGCCAGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link