tacc1

Ensembl ID:
ENSDARG00000073753
ZFIN ID:
ZDB-GENE-090521-5
Human Orthologue:
TACC1
Human Description:
transforming, acidic coiled-coil containing protein 1 [Source:HGNC Symbol;Acc:11522]
Mouse Orthologue:
Tacc1
Mouse Description:
transforming, acidic coiled-coil containing protein 1 Gene [Source:MGI Symbol;Acc:MGI:2443510]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa41638 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa41638
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000091156 Nonsense 144 535 1 11
Genomic Location (Zv9):
Chromosome 10 (position 20554027)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 20515441
GRCz11 10 20472822
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTGACCCAAATCAGTGGGACGATCCCAACTTTGATCCATTTGGTGGGAAA[C/T]AAAAACTTAGCAGCTCGCCGACGCTTCCTAAAGGATCGTATAGTTTTGAC
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link