si:dkey-266j7.2

Ensembl ID:
ENSDARG00000073752
ZFIN ID:
ZDB-GENE-060503-162
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A3QK21]
Human Orthologue:
CACNA2D1
Human Description:
calcium channel, voltage-dependent, alpha 2/delta subunit 1 [Source:HGNC Symbol;Acc:1399]
Mouse Orthologue:
Cacna2d1
Mouse Description:
calcium channel, voltage-dependent, alpha2/delta subunit 1 Gene [Source:MGI Symbol;Acc:MGI:88295]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa36580 Essential Splice Site Mutation detected in F1 DNA During 2018
sa39191 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa36580
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080995 Essential Splice Site 41 548 1 18
ENSDART00000143965   None 76 None 3
Genomic Location (Zv9):
Chromosome 18 (position 9186161)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9763138
GRCz11 18 9732328
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGCATCTGTTCATATCTCGTGCCCATCGCAGTTTCCCAGTCCGCTCATG[T/C]AAGTTCTTTGATGTTGTTTTCGCGTCAACTGGTGATTAAATACAGCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39191
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000080995 Essential Splice Site 68 548 2 18
ENSDART00000143965   None 76 None 3
Genomic Location (Zv9):
Chromosome 18 (position 9205017)
Other Location(s):
Assembly Chromosome Position
GRCz10 18 9781994
GRCz11 18 9751184
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCTGGTTTCATTAGCAGACACAGCCAGTGCTGGAGATAATCTGAGACAG[G/A]TCAGAGGTCTAAAACTTCTCACATGCACACAGTCTCACACACACAAATAC
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link