si:dkeyp-46c9.6

Ensembl ID:
ENSDARG00000073738
ZFIN ID:
ZDB-GENE-081105-71
Description:
Novel protein similar to vertebrate DENN/MADD domain containing 2C (DENND2C) [Source:UniProtKB/TrEMB
Human Orthologue:
DENND2C
Human Description:
DENN/MADD domain containing 2C [Source:HGNC Symbol;Acc:24748]
Mouse Orthologue:
Dennd2c
Mouse Description:
DENN/MADD domain containing 2C Gene [Source:MGI Symbol;Acc:MGI:3036254]

Alleles

There are 8 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa34321 Nonsense Available for shipment Available now
sa34322 Nonsense Mutation detected in F1 DNA During 2018
sa16106 Splice Site, Nonsense Available for shipment Available now
sa34323 Nonsense Mutation detected in F1 DNA During 2018
sa15429 Nonsense Available for shipment Available now
sa34324 Splice Site, Nonsense Mutation detected in F1 DNA During 2018
sa34325 Essential Splice Site Mutation detected in F1 DNA During 2018
sa9597 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa34321
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109877 Nonsense 126 920 1 18
ENSDART00000143844   None 531 None 15
Genomic Location (Zv9):
Chromosome 8 (position 11640125)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11028999
GRCz11 8 11066704
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATCGAGATCATTTAAATAAATGTGTTACCCCAAGCACTGTATCACAAGTC[C/T]AAGTGGCTAAACCGAATGTAAAAATCAATAATATCAACTCCAGCCATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34322
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109877 Nonsense 308 920 2 18
ENSDART00000143844   None 531 None 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11645839)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11023285
GRCz11 8 11060990
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GAGAGCCGCCGCTCGGGTCTTTATCACGCCCTGTCTGAAGACAGCATCTA[T/A]GAGGACATCATCTGTGAGTTATACTGATATCATCCAACTGGTATTACTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa16106
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109877 Splice Site, Nonsense 313 920 3 18
ENSDART00000143844   None 531 None 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11648867)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11020257
GRCz11 8 11057962
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTTACAATGTTATCTATAATCTTCAACRTTTTTTAACTATTTGTTTGCAG[C/A]GGATATGCCAAAAGAAAACCCATATGAAGATATCACGCTTTCTCCCATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34323
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109877 Nonsense 336 920 3 18
ENSDART00000143844   None 531 None 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11648935)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11020189
GRCz11 8 11057894
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCCATATGAAGATATCACGCTTTCTCCCATGTGTTTACCTATAAGGCGG[C/T]AACGAAACTACACAGTTGGACAAAGAGAAAGGCCACAGCTCAAGGTGACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15429
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109877 Nonsense 337 920 3 18
ENSDART00000143844   None 531 None 15

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 11648938)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11020186
GRCz11 8 11057891
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CATATGAAGATATCACGCTTTCTCCCATGTGTTTACCTATAAGGCGGCAA[C/T]GAAACTACACAGTTGGACAAAGAGAAAGGCCACAGCTCAAGGTGACTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34324
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109877 Splice Site, Nonsense 432 920 6 18
ENSDART00000143844 Splice Site, Nonsense 43 531 3 15
Genomic Location (Zv9):
Chromosome 8 (position 11661432)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11007692
GRCz11 8 11045397
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACCAATAGAAAAAGTGGAATAGATCAGTGAAAGTGTGTTTTCTGGCAGAG[G/T]AATTGAGTGGGACAGAAAGTGATCCCGAGGAGAACTCTAAAGGTCAGTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34325
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > G
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109877 Essential Splice Site 446 920 6 18
ENSDART00000143844 Essential Splice Site 57 531 3 15
Genomic Location (Zv9):
Chromosome 8 (position 11661476)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11007648
GRCz11 8 11045353
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAGAGGAATTGAGTGGGACAGAAAGTGATCCCGAGGAGAACTCTAAAGG[T/G]CAGTGTCTCCCTTAGGCCTCAGCAAACATGACTCTTGTTTACTCTAGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9597
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109877 Essential Splice Site 545 920 8 18
ENSDART00000143844 Essential Splice Site 156 531 5 15
Genomic Location (Zv9):
Chromosome 8 (position 11663280)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 11005844
GRCz11 8 11043549
KASP Assay ID:
554-6564.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TTWGTTTTCCTGACTGTCATGACTGGYGTCCCTCCTCMGAYCACACCAGG[T/C]AACATWTCAACAWTAAACCTTTYATTATAGTTGTCTGACTAGTTCACTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link