suds3

Ensembl ID:
ENSDARG00000073737
ZFIN ID:
ZDB-GENE-040801-236
Description:
sin3 histone deacetylase corepressor complex component SDS3 [Source:RefSeq peptide;Acc:NP_001003493
Human Orthologue:
SUDS3
Human Description:
suppressor of defective silencing 3 homolog (S. cerevisiae) [Source:HGNC Symbol;Acc:29545]
Mouse Orthologue:
Suds3
Mouse Description:
suppressor of defective silencing 3 homolog (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:1919204]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa9868 Nonsense Available for shipment Available now
sa40378 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa9868
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109590 Nonsense 167 317 7 13
ENSDART00000111646 Nonsense 177 318 7 12
ENSDART00000114446 Nonsense 169 318 7 12
Genomic Location (Zv9):
Chromosome 5 (position 17272265)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15000919
GRCz11 5 15501136
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GYATTTTAGATTCTATGGAGGTAAAACCTATCATGACCCGGAAGCTCCGG[C/T]GACGACCCAATGACCCTGTGCCCATTCCAGACAAGMGGAGAAAGCCTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40378
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000109590 Essential Splice Site 221 317 10 13
ENSDART00000111646 Essential Splice Site 223 318 10 12
ENSDART00000114446 Essential Splice Site 223 318 10 12
Genomic Location (Zv9):
Chromosome 5 (position 17274969)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 15003623
GRCz11 5 15503840
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAAATTGAATTGCAAATAAACTGAAAATCTATGTTTTGGGATGTTTCTTA[G/A]CCTCCCCGTCTTCTCCAGAGCACCTCCCGTCCACTCCAGTTGACACCCCA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link