si:dkey-76p7.6

Ensembl ID:
ENSDARG00000073721
ZFIN ID:
ZDB-GENE-091113-61
Human Orthologue:
SMARCAD1
Human Description:
SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing D
Mouse Orthologue:
Smarcad1
Mouse Description:
SWI/SNF-related, matrix-associated actin-dependent regulator of chromatin, subfamily a, containing D

Alleles

There are 4 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa11433 Nonsense Available for shipment Available now
sa41629 Nonsense Mutation detected in F1 DNA During 2018
sa21706 Nonsense Available for shipment Available now
sa41628 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa11433
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Nonsense 366 954 9 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17601581)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17613927
GRCz11 10 17571361
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAAAGAGCAACACTTTCACKCTTCTTTGTCTCAGGATGATGCCATGCGC[A/T]GAAGAAACGGTYTGTCCGCTGAGCTCCTGGCAGGATGTCGAGAGGTTCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41629
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Nonsense 660 954 17 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17593495)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17605841
GRCz11 10 17563275
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CACTCGAGTGGTTCACTGACAGATGATGATGTGCCCGACAGGTCCTGAAG[C/T]AGCTGCCTGCCAAAGAGGAGCAGGTTGAATTTTGTGCCATGTCCGAGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21706
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Nonsense 924 954 22 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17583418)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17595764
GRCz11 10 17553198
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTAAGGACTCCATAGAGGACACCATGCTTCGAATTGGAGAAAGAAAACTC[A/T]AACTAGAGCAGGAAATGACCGCAACTCAGGACGGTGAGAACACTAATAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41628
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113101 Essential Splice Site 935 954 22 23

The following transcripts of ENSDARG00000073721 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 10 (position 17583383)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 17595729
GRCz11 10 17553163
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GGAGAAAGAAAACTCAAACTAGAGCAGGAAATGACCGCAACTCAGGACGG[T/A]GAGAACACTAATAAAGCTGACAGGGATTTTATTTACCTGACCTATGTTTT
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link