si:dkey-250l23.4

Ensembl ID:
ENSDARG00000073720
ZFIN ID:
ZDB-GENE-081104-393
Description:
Novel protein similar to vertebrate ring finger protein 180 (RNF180) [Source:UniProtKB/TrEMBL;Acc:B0
Human Orthologue:
RNF180
Human Description:
ring finger protein 180 [Source:HGNC Symbol;Acc:27752]
Mouse Orthologue:
Rnf180
Mouse Description:
ring finger protein 180 Gene [Source:MGI Symbol;Acc:MGI:1919066]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa31664 Nonsense Available for shipment Available now
sa34439 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa31664
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092915 Nonsense 171 365 2 5
ENSDART00000137647 Nonsense 169 363 2 5
Genomic Location (Zv9):
Chromosome 8 (position 32783795)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31926521
GRCz11 8 31935753
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GTCTGAGTAAAAGAGAGAGAAGGAGGATGAGGAGCCTGAGAAGGAGACAG[C/T]GAAGGAGAGATCTCTGCCGACTAGAAAATCTGCAGGTGAAGCACGAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34439
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000092915 Essential Splice Site 256 365 3 5
ENSDART00000137647 Essential Splice Site 254 363 3 5
Genomic Location (Zv9):
Chromosome 8 (position 32777608)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 31920334
GRCz11 8 31929566
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCCTGCCCACTCTGCAGGACCACCATCACACACGTCTTCTTCCAGAAGG[G/T]TCGGTCTCACATAATAATATTACATTTAAAAAGTCTTTCTTTCTTTCTTT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link