wu:fk86g11

Ensembl ID:
ENSDARG00000073713
ZFIN IDs:
ZDB-GENE-030131-7134, ZDB-GENE-070912-250
Description:
Novel protein similar to vertebrate netrin G1 (NTNG1) [Source:UniProtKB/TrEMBL;Acc:B0S6C7]
Human Orthologue:
NTNG1
Human Description:
netrin G1 [Source:HGNC Symbol;Acc:23319]
Mouse Orthologue:
Ntng1
Mouse Description:
netrin G1 Gene [Source:MGI Symbol;Acc:MGI:1934028]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa19708 Nonsense Available for shipment Available now
sa25783 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa19708
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105742 Nonsense 13 355 1 3
Genomic Location (Zv9):
Chromosome 2 (position 15610765)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16121592
GRCz11 2 15790182
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAATCCGCAACCATGCATTTTCTGCTAGCGTTTGTACTACAGGCCCTGTG[G/A]GTGAATTGGTGTCACGCCACACAGCATTACCTGGCCTCGTGGGGGCATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25783
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105742 Nonsense 21 355 1 3
Genomic Location (Zv9):
Chromosome 2 (position 15610787)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16121614
GRCz11 2 15790204
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTAGCGTTTGTACTACAGGCCCTGTGGGTGAATTGGTGTCACGCCACA[C/T]AGCATTACCTGGCCTCGTGGGGGCATTATGATGTTTGTAAGTCTCAGGTA
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link