usp7

Ensembl ID:
ENSDARG00000073710
ZFIN ID:
ZDB-GENE-030131-3656
Description:
Usp7 protein [Source:UniProtKB/TrEMBL;Acc:Q52KL0]
Human Orthologue:
USP7
Human Description:
ubiquitin specific peptidase 7 (herpes virus-associated) [Source:HGNC Symbol;Acc:12630]
Mouse Orthologue:
Usp7
Mouse Description:
ubiquitin specific peptidase 7 Gene [Source:MGI Symbol;Acc:MGI:2182061]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa20019 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa20019
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000024453 Essential Splice Site 690 1110 18 31
Genomic Location (Zv9):
Chromosome 3 (position 27780027)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 27498066
GRCz11 3 27628908
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCCAGAAATGGCCGCCAGTGGTGCAACGTTACCCAAATTTGACAAAGACC[G/A]TGAGTTTCAACTTGTATAATTTGAATATACTCGATTGTTTCAGGCTGTGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link