si:dkey-92k1.12

Ensembl ID:
ENSDARG00000073707
ZFIN ID:
ZDB-GENE-030131-8048
Human Orthologue:
CNKSR2
Human Description:
connector enhancer of kinase suppressor of Ras 2 [Source:HGNC Symbol;Acc:19701]
Mouse Orthologue:
Cnksr2
Mouse Description:
connector enhancer of kinase suppressor of Ras 2 Gene [Source:MGI Symbol;Acc:MGI:2661175]

Alleles

There are 5 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa23944 Nonsense Available for shipment Available now
sa23943 Nonsense Available for shipment Available now
sa29600 Essential Splice Site Available for shipment Available now
sa43650 Nonsense Mutation detected in F1 DNA During 2018
sa39329 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa23944
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Nonsense 36 963 2 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24770665)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25456339
GRCz11 21 25492944
KASP Assay ID:
2261-5659.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTTTAAGGCTTGGATGACTGTCTGCAGCAGTACATTAAGAACTTTGAG[C/T]AGGAGAAGGTTGGCGGTGAGCAGCTGTTGAGAATCACGCATCAGGAGCTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa23943
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Nonsense 74 963 2 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24770549)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25456223
GRCz11 21 25492828
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTCGAATCGGCCACCAGGAGCTCATTCTGGAGGCCGTGGACCTGTTGTG[T/A]GCGCTGGTGAGCTCCTACACAAACACATACCAAAGACAAACTGAATCTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa29600
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Essential Splice Site 144 963 3 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24762023)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25447697
GRCz11 21 25484302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCGTGGACCTCATCGCTGCCGCCAAGAGCCTGCTGGCATGGCTGGATAGG[T/C]TAGTCTTGCAAAGAGACACAAATACACACTTAAACAGACACAAACAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43650
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Nonsense 183 963 5 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24747854)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25433528
GRCz11 21 25470133
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATTTTTCTTTTCTTGCCTTTCAGGACGGCACAGTGTATGAGACCGAGAAT[A/T]AGATACTGCATGTGGTAAGACTGACATTTATTTTCTCACACAATCTCAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39329
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000110923 Essential Splice Site 947 963 21 22

The following transcripts of ENSDARG00000073707 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 24706648)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 25392322
GRCz11 21 25428927
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TACTCAACGAGAAACTGCACCGCCTGCGCATCCTGCAAAACTCATTCAAG[G/A]TACAGTAAGCACATGCTGCAGACGGTCAACATTTACACACACACACGCAT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link