zgc:194937

Ensembl ID:
ENSDARG00000073699
ZFIN ID:
ZDB-GENE-080721-25
Description:
hypothetical protein LOC100170785 [Source:RefSeq peptide;Acc:NP_001124096]
Human Orthologue:
COL9A1
Human Description:
collagen, type IX, alpha 1 [Source:HGNC Symbol;Acc:2217]
Mouse Orthologue:
Col9a1
Mouse Description:
collagen, type IX, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88465]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa15187 Nonsense Available for shipment Available now
sa27738 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa15187
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113311 Nonsense 130 687 8 32
Genomic Location (Zv9):
Chromosome 11 (position 11418956)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11313959
GRCz11 11 11297580
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTGAATTGTWWTCTTTTCTGTCNTGAAGGGTGCTGATGGAGATGATGGTT[T/A]ACCTGGTGAGATGGGAAAAGTTGGACCTCCAGTATGTGATGTCATTCCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27738
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113311 Essential Splice Site 384 687 23 32
Genomic Location (Zv9):
Chromosome 11 (position 11410807)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 11305810
GRCz11 11 11289431
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ATGTGTAGAAATGTATCTCTTCTATAATCTTTTTTCTATTTTTTTTTTCC[A/T]GGGTGAAAGAGGAGCAAGAGGTCCTGATGGGCCTGCAGGCCTTCCAGGTG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link