NAV2 (1 of 2)
- Ensembl ID:
- ENSDARG00000073688
- Description:
- neuron navigator 2 [Source:HGNC Symbol;Acc:15997]
- Human Orthologue:
- NAV2
- Human Description:
- neuron navigator 2 [Source:HGNC Symbol;Acc:15997]
- Mouse Orthologue:
- Nav2
- Mouse Description:
- neuron navigator 2 Gene [Source:MGI Symbol;Acc:MGI:2183691]
Alleles
There are 10 alleles of this gene:
Allele name |
Consequence |
Status |
Availability Estimate |
sa15972 |
Nonsense |
Available for shipment |
Available now |
sa40851 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa30884 |
Essential Splice Site |
Mutation detected in F1 DNA |
During 2018 |
sa34024 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa7061 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
sa15602 |
Nonsense |
Available for shipment |
Available now |
sa10172 |
Nonsense |
Available for shipment |
Available now |
sa9986 |
Essential Splice Site |
Available for shipment |
Available now |
sa31554 |
Essential Splice Site |
Available for shipment |
Available now |
sa25358 |
Nonsense |
Mutation detected in F1 DNA |
During 2018 |
Mutation Details
- Allele Name:
- sa15972
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Nonsense |
56 |
2347 |
1 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17581878)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16554667 |
GRCz11 |
7 |
16806640 |
- KASP Assay ID:
- 2259-8566.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AGCCCCCYRCAGAGCAGCGCTCATCTCCACCTCCAGAGCCAAAGYGGGTG[G/A]ATGACAAGCAAAAACTATCRCAATGTTGACAGTGGAGAGGACACACAGGT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa40851
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Essential Splice Site |
267 |
2347 |
6 |
37 |
ENSDART00000113332 |
Essential Splice Site |
267 |
2347 |
6 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17680574)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16653363 |
GRCz11 |
7 |
16905336 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTCTGGTGTTCAGCGATAAAGCCAAACCTGCAGCAGCTCAGGCCAAAG[G/A]TAAACACAACTGAATTACTTTAGCTGAACACTGCACTTGCAGACTCATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa30884
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Essential Splice Site |
267 |
2347 |
6 |
37 |
ENSDART00000113332 |
Essential Splice Site |
267 |
2347 |
6 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17680574)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16653363 |
GRCz11 |
7 |
16905336 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGTCTGGTGTTCAGCGATAAAGCCAAACCTGCAGCAGCTCAGGCCAAAG[G/A]TAAACACAACTGAATTACTTTAGCTGAACACTGCACTTGCAGACTCATTC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa34024
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Nonsense |
459 |
2347 |
7 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17691323)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16664112 |
GRCz11 |
7 |
16916085 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CAGCGAAATCTTCAGAGAAAGAAAAGGGCAAAGACAAAAATGCATCCAAG[C/T]GAGGCTCTCCTTCAGAAAAGGTAGAGGAGGTCAAGGAAGAAGTGGTTTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa7061
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- G > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Nonsense |
684 |
2347 |
9 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17694429)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16667218 |
GRCz11 |
7 |
16919191 |
- KASP Assay ID:
- 554-4569.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GGCGCCTGAGGACTGTCAAAAACATCGCTGACCTGCGGCARAATYTAGAA[G/T]AAACCATGTCCAGTTTACGGGGGACACAAATCACTCACAGGTAGACANTTT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa15602
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Nonsense |
765 |
2347 |
10 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17697513)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16670302 |
GRCz11 |
7 |
16922275 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- AATGGGTATCAGTCCYGCAGCGGRGGGGTTGCAYCCGGCCAGGGCCGCTA[T/A]CTGTATCAGGCTCCCCTACGGAAGCAGCTGGCAGCACGCGGCAGTGGTCT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa10172
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- C > A
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Nonsense |
1024 |
2347 |
14 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17732811)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16705600 |
GRCz11 |
7 |
16957573 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- TTTMATCCRTTAGGCAAAACAGATGACGCCAAGGTYTCGGAAAAAGGTYG[C/A]ATGTCTCCCTCTTCCAACATCCTTCAGCATTCCTCCTCRGACACYGGCCG
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa9986
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
Order Allele From EZRC
- Mutation:
- G > A
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Essential Splice Site |
1695 |
2347 |
25 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17774394)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16747183 |
GRCz11 |
7 |
16999156 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- GCTGTTTTTCAGKAACTCTAGACTCATGACCTGTCTCTGTTATCATTGCA[G/A]CTTCGCAGCTCCTTCAAACAGGCCTTCAGTAAGAAGAAATCCCCTAAATC
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa31554
- Current Status:
-
Available for shipment
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
-
Order Allele From ZIRC
- Mutation:
- T > G
- Consequence:
- Essential Splice Site
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Essential Splice Site |
1923 |
2347 |
29 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17779695)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16752484 |
GRCz11 |
7 |
17004457 |
- KASP Assay ID:
- None (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- AAAAACCAAGTGGGATGTTCTCGATGGAGTTGTACGGCGCTTGTTTAAGG[T/G]AAATACATTTATAATAATTATTTGATGAGGATGAGTCATTTACATTACAT
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25358
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this
status and other statuses, please see our FAQs.
- Availability:
- We currently estimate that this allele will be available during
2018.
- Mutation:
- A > T
- Consequence:
- Nonsense
Transcript ID |
Consequence |
Amino Acid Affected |
Amino Acid Total |
Exon Affected |
Exon Total |
ENSDART00000113332 |
Nonsense |
2106 |
2347 |
32 |
37 |
- Genomic Location (Zv9):
- Chromosome 7 (position 17783550)
- Other Location(s):
-
Assembly |
Chromosome |
Position |
GRCz10 |
7 |
16756339 |
GRCz11 |
7 |
17008312 |
- KASP Assay ID:
- 554-7786.1 (used for ordering genotyping assays from
LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TGCACCACATCAGCTCACTGGGAGAGATCTTCAGTGGCCTCCTCAATTGC[A/T]GATACCAGCGCTGGTCAGTCAGCATTTATAAACACACTACCATTCAAACA
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes
(for example, a new allele is generated or an allele is made available
for distribution) then please enter your details below: