zgc:172359

Ensembl ID:
ENSDARG00000073686
ZFIN ID:
ZDB-GENE-080204-118
Description:
HEAT repeat-containing protein 6 [Source:UniProtKB/Swiss-Prot;Acc:A9JRI0]
Human Orthologue:
HEATR6
Human Description:
HEAT repeat containing 6 [Source:HGNC Symbol;Acc:24076]
Mouse Orthologue:
Heatr6
Mouse Description:
HEAT repeat containing 6 Gene [Source:MGI Symbol;Acc:MGI:1919790]

Alleles

There are 6 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa43697 Nonsense Mutation detected in F1 DNA During 2018
sa32356 Essential Splice Site Available for shipment Available now
sa11893 Nonsense Available for shipment Available now
sa25166 Nonsense Mutation detected in F1 DNA During 2018
sa37362 Essential Splice Site Mutation detected in F1 DNA During 2018
sa43698 Essential Splice Site Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa43697
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113316 Nonsense 126 1201 2 21
Genomic Location (Zv9):
Chromosome 21 (position 37707673)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38699708
GRCz11 21 38747414
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCCTCTAAGTCAAGAACATCTCATCATCAAACTCTGCCAAATGATTCAT[C/T]AACTTCTAAACCAGCTACAGGTATTTACCATAGGGTTGGGTTAAATGGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32356
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113316 Essential Splice Site 179 1201 3 21
Genomic Location (Zv9):
Chromosome 21 (position 37708832)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38700867
GRCz11 21 38748573
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCTTGCTCTTTCGTCACTGGTGTATGGCAATGGATCCAAATGCCAAAGG[G/T]TAAGAATTGCTGATATGGAAGCTCTCTCTTTTTTTTTTCTGGATGTTTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11893
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113316 Nonsense 441 1201 9 21
Genomic Location (Zv9):
Chromosome 21 (position 37728314)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38720349
GRCz11 21 38768055
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GCTCGTGTGCGTCAGAGTTCACTTCAGTGTTTCCTGGCTGTGGTCAAGTG[T/A]GTGGAGAAGCGAATCCTCTATGGTTACTGGTCTTCGTTTGTTCCCGACGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25166
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113316 Nonsense 796 1201 15 21
Genomic Location (Zv9):
Chromosome 21 (position 37739973)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38732008
GRCz11 21 38779714
KASP Assay ID:
554-7526.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TAGGTGGTCCACTCATCAGTGCCTTACAGAATGAACATCATCCGACCCTT[C/T]AGACCAGCGCGTGCGACACCCTCTCCTCCATCCTGCCACAGGCCTTCAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37362
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113316 Essential Splice Site 815 1201 15 21
Genomic Location (Zv9):
Chromosome 21 (position 37740033)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38732068
GRCz11 21 38779774
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CGTGCGACACCCTCTCCTCCATCCTGCCACAGGCCTTCAGTCAGCTGCCC[G/A]TGAGTGCCTGTGTAATGCAGTGTTGAGTTATTAATTGTTATTGTGGTATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43698
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
A > T
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000113316 Essential Splice Site 999 1201 20 21
Genomic Location (Zv9):
Chromosome 21 (position 37749729)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 38741764
GRCz11 21 38789470
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AAAAACAAAAAGAAGCTGTTGGTGTCTGTAATACGTCTTTCTTCACTCTC[A/T]GGTTCTGCTGTGTGGTCTACGGAGGCTTTCTCTGCCCTGTCCTGTGTAGT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link