ZFHX3

Ensembl ID:
ENSDARG00000073681
Description:
zinc finger homeobox 3 [Source:HGNC Symbol;Acc:777]
Human Orthologue:
ZFHX3
Human Description:
zinc finger homeobox 3 [Source:HGNC Symbol;Acc:777]
Mouse Orthologue:
Zfhx3
Mouse Description:
zinc finger homeobox 3 Gene [Source:MGI Symbol;Acc:MGI:99948]

Alleles

There are 11 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa41077 Nonsense Mutation detected in F1 DNA During 2018
sa7104 Nonsense Mutation detected in F1 DNA During 2018
sa34236 Nonsense Mutation detected in F1 DNA During 2018
sa21139 Nonsense Available for shipment Available now
sa18256 Nonsense Available for shipment Available now
sa7105 Nonsense Mutation detected in F1 DNA During 2018
sa38655 Nonsense Mutation detected in F1 DNA During 2018
sa31615 Nonsense Mutation detected in F1 DNA During 2018
sa13265 Nonsense Available for shipment Available now
sa13073 Nonsense Available for shipment Available now
sa21140 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa41077
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 361 3838 1 9
Genomic Location (Zv9):
Chromosome 7 (position 70494962)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 68137680
GRCz11 7 68372374
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGCAGTCCATGACCATCGCATGACTCTATGTGAGGACGAGCGCAGACTTT[T/A]AGGCCACAAGCATGCATCGGCCATTATACAGGGCATTGGGAAAGACAAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7104
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 434 3838 1 9
Genomic Location (Zv9):
Chromosome 7 (position 70495181)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 68137461
GRCz11 7 68372155
KASP Assay ID:
554-5453.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
GGGCAGCAGTAGTGAGGGAGGTGAGAGCCTCCTCAACAAAGACTCTGACT[C/A]GGGTCTCCARCAACAAGCCCTTCTCACATTGGGGGGGCTAGGCAGCCCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa34236
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 517 3838 1 9
Genomic Location (Zv9):
Chromosome 7 (position 70495430)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 68137212
GRCz11 7 68371906
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTGCTTCCTGGTGAGGAGATGCCCTCAGATGAAGAGGATGAGCTTCTTT[T/A]AGAAGAAGAGGATGAAGAGGTAGAGGATGAAGGCACTGCGGTGGCCTGTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21139
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 718 3838 1 9
Genomic Location (Zv9):
Chromosome 7 (position 70496034)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 68136608
GRCz11 7 68371302
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
ACACACCTCCATCACACAGCTGCTTGTGACTTGTCAGGAATAAGTGAATG[C/A]ACCCAGAACCATGGGGCTGGGGGCAGTGGAGGAAGTGGGGTAGAGTGCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18256
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 760 3838 1 9
Genomic Location (Zv9):
Chromosome 7 (position 70496160)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 68136482
GRCz11 7 68371176
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCTCGCTCATTGGGTGGCCATATGACCATGATGCACTCACGAAATTCGTG[C/A]AAGACACTAAAGTGTCCYAAGTGCAAYTGGCACTACAAATACCAGCAGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7105
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 1385 3838 6 9
Genomic Location (Zv9):
Chromosome 7 (position 70635249)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67997393
GRCz11 7 68232087
KASP Assay ID:
554-5425.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TGTTTCGCTGCCCGYTGTGCCAGGAYATGCTCAACAACAAGGTCCACCTG[C/T]AGTTCCATCTCACCCACCTCCACAGCGTGGCACCAGACTGCGTGGACAAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38655
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 1877 3838 8 9
Genomic Location (Zv9):
Chromosome 7 (position 70641674)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67990968
GRCz11 7 68225662
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGCAGCAGCAGTTGGCCCAGGCTCAAGCACAGGCACAGGCTCAGCTCCAG[C/T]AGGAGCTCCAGCAGGCCGCACTCCTTCAGTCCCAGCTTTTTAACCCTCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31615
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 1880 3838 8 9
Genomic Location (Zv9):
Chromosome 7 (position 70641683)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67990959
GRCz11 7 68225653
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
AGTTGGCCCAGGCTCAAGCACAGGCACAGGCTCAGCTCCAGCAGGAGCTC[C/T]AGCAGGCCGCACTCCTTCAGTCCCAGCTTTTTAACCCTCTTCTCCAGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13265
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 2377 3838 8 9
Genomic Location (Zv9):
Chromosome 7 (position 70643176)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67989466
GRCz11 7 68224160
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
AAAATTGATTCAAAACCCCCCTCCCCTGAACCTCTAAAACAGGAAGCATA[T/A]GGAAATAAGCGGTCTTCAAGAACACGGTTCACAGACTACCAACTGAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13073
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 2422 3838 8 9
Genomic Location (Zv9):
Chromosome 7 (position 70643309)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67989333
GRCz11 7 68224027
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTAAAGATGATGAATTTGAGCAGTTATCTAATCTCCTGAACCTTCCAACT[C/T]GAGTAATTGTTRTGTGGTTTCAAAATGCCAGACAAAAAGCCCGTAAAAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21140
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000114582 Nonsense 3518 3838 9 9
Genomic Location (Zv9):
Chromosome 7 (position 70646706)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 67985936
GRCz11 7 68220630
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
GCAACAGCGGCAGCTTCAGCAGATCCAGCAGCCCAAAGCAAGCCAAACTT[C/A]ACAAAACTCGGTGGACCGCAAGGACTCTGCCAAAGATTCAGTAAAAACAG
Associated Phenotype:
Not determined

GWAS

This gene's human homologue has been identified in the following GWAS studies:

(GWAS data comes from http://www.genome.gov/gwastudies/.)

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link