zgc:153259

Ensembl ID:
ENSDARG00000071881
ZFIN ID:
ZDB-GENE-060825-210
Description:
ADP-ribosylation factor-like protein 9 [Source:RefSeq peptide;Acc:NP_001038852]
Human Orthologue:
ARL9
Human Description:
ADP-ribosylation factor-like 9 [Source:HGNC Symbol;Acc:23592]
Mouse Orthologue:
Arl9
Mouse Description:
ADP-ribosylation factor-like 9 Gene [Source:MGI Symbol;Acc:MGI:1915496]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa4540 Nonsense F2 line generated During 2018
sa42321 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa4540
Current Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106672 Nonsense 34 241 1 4
Genomic Location (Zv9):
Chromosome 14 (position 1209993)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1186567
GRCz11 14 1200499
KASP Assay ID:
554-3568.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTGGMGGCGTCGCGTGCGCGCTCTGCTACCTGACGCAGAAAACAACACAA[C/T]AAGAGCCAAAGAAAAAACCCAAAGAAGAGCCCAAAGAGMAACCAGAACAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42321
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106672 Nonsense 138 241 3 4
Genomic Location (Zv9):
Chromosome 14 (position 1203600)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 1180174
GRCz11 14 1194193
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTTGTGCAGTCGGAGGTTCAGAGAAGCTGCGTGAGTACTGGCGGATGTA[T/A]CTGAGTAAAGCTCGTGTGCTGGTGTTCGTGGTGGACTCGTCTGATCCGGA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link