zgc:136859

Ensembl ID:
ENSDARG00000071876
ZFIN ID:
ZDB-GENE-060421-6581
Description:
hypothetical protein LOC678542 [Source:RefSeq peptide;Acc:NP_001035391]
Human Orthologue:
RELL2
Human Description:
RELT-like 2 [Source:HGNC Symbol;Acc:26902]
Mouse Orthologue:
Rell2
Mouse Description:
RELT-like 2 Gene [Source:MGI Symbol;Acc:MGI:1918044]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa16678 Nonsense Available for shipment Available now
sa35639 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16678
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063559 Nonsense 147 401 4 5
ENSDART00000134935 Nonsense 147 158 5 5
Genomic Location (Zv9):
Chromosome 14 (position 9641745)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9163585
GRCz11 14 9469599
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
TCAGCTCTTGYRTTCACTGCATGCAAGGACAAATCTTAAAAACGCGACGC[A/T]GAAGCCGCGTGGCCARAAGCAAAGCCCGGCCAGGAGAGCAGACTGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35639
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000063559 Nonsense 271 401 5 5
ENSDART00000134935   None 158 None 5
Genomic Location (Zv9):
Chromosome 14 (position 9647017)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 9168857
GRCz11 14 9474871
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TGTGGAGATCAAAGCAGGGCCGGAAGTATTTGTGGAGGACAAAGAAGGAT[C/A]AACCACTGCTGATCAGCTCTCCATCTCACTGGAAGAATGCTTGAGCTCCG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link