zdhhc15b

Ensembl ID:
ENSDARG00000071872
ZFIN ID:
ZDB-GENE-061110-106
Description:
palmitoyltransferase ZDHHC15 [Source:RefSeq peptide;Acc:NP_001071249]
Human Orthologue:
ZDHHC15
Human Description:
zinc finger, DHHC-type containing 15 [Source:HGNC Symbol;Acc:20342]
Mouse Orthologue:
Zdhhc15
Mouse Description:
zinc finger, DHHC domain containing 15 Gene [Source:MGI Symbol;Acc:MGI:1915336]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa35646 Essential Splice Site Mutation detected in F1 DNA During 2018
sa10212 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa35646
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
G > A
Consequence:
Essential Splice Site
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106658 Essential Splice Site 144 332 6 12

The following transcripts of ENSDARG00000071872 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 11157196)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10652553
GRCz11 14 10958567
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTTTGCTGTGTCTCATTTAATGGTTTTATGTTCCTGTTTGTTTTTTTATA[G/A]ATGTGTTTTGAAGATGGATCACCACTGTCCATGGTAAATGGAGAATATTA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10212
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106658 Nonsense 184 332 7 12

The following transcripts of ENSDARG00000071872 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 11158734)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 10654091
GRCz11 14 10960105
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CTTTCTACTGTTCCTGTCTTACTCCATGATCTACTGTGTGTTCATCGCAT[C/A]GACARTGTTTCAGTATTTCCTCAAGTTCTGGGTGGTGAGTTTMAGCAAGG
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link