zgc:112315

Ensembl ID:
ENSDARG00000071871
ZFIN ID:
ZDB-GENE-050522-174
Description:
Glyoxalase domain-containing protein 5 [Source:UniProtKB/Swiss-Prot;Acc:Q502D1]
Human Orthologue:
GLOD5
Human Description:
glyoxalase domain containing 5 [Source:HGNC Symbol;Acc:33358]
Mouse Orthologue:
Glod5
Mouse Description:
glyoxalase domain containing 5 Gene [Source:MGI Symbol;Acc:MGI:1917074]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa42357 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa42357
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106657 Nonsense 163 163 4 4
Genomic Location (Zv9):
Chromosome 14 (position 11597935)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 11093292
GRCz11 14 11399306
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TCTATTTTCGTGACCCTGATGACAACTTGATTGAAGTGTCCAATTACCAG[C/T]AATAGACAGGAGGAGGTGCTCTATCATCAGCTACAAATCTACTCTCTGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link