si:dkeyp-53d3.3

Ensembl ID:
ENSDARG00000071862
ZFIN ID:
ZDB-GENE-050208-644
Description:
Si:dkeyp-53d3.3 protein [Source:UniProtKB/TrEMBL;Acc:A4IGF8]

Alleles

There is 1 allele of this gene:

Allele name Consequence Status Availability Estimate
sa17880 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa17880
Current Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106631 Nonsense 242 244 2 3
Genomic Location (Zv9):
Chromosome 22 (position 2611691)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 1424539
GRCz11 22 1441437
KASP Assay ID:
None (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
CACAATTAGCAAGCCTTAAATATCACATGAGGAGCCACACTGGAGAGAAA[C/T]ARCCCGAATGACACATTTGGAAAAATTGAAAAYCGCAWACTCNNAGAGTA
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link