zgc:174224

Ensembl ID:
ENSDARG00000071819
ZFIN IDs:
ZDB-GENE-050420-147, ZDB-GENE-071004-118
Description:
Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZC1]

Alleles

There are 2 alleles of this gene:

Allele name Consequence Status Availability Estimate
sa25171 Nonsense Mutation detected in F1 DNA During 2018
sa25172 Nonsense Mutation detected in F1 DNA During 2018

Mutation Details

Allele Name:
sa25171
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
C > T
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106503   None 200 None 3
ENSDART00000143499 Nonsense 27 140 2 4
Genomic Location (Zv9):
Chromosome 22 (position 1543101)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2284191
GRCz11 22 2300457
KASP Assay ID:
554-7402.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
TTCTCTGTTTGTTCTCCTGAAGCTCTGCCGCCATCAGTGAAAGACAAAGA[C/T]AGAGTTTATTGAAGGACAGTGAGAAGATGAGTGATCCAGAACCCTGCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25172
Current Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
We currently estimate that this allele will be available during 2018.
Mutation:
T > A
Consequence:
Nonsense
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106503 Nonsense 144 200 3 3
ENSDART00000143499   None 140 4 4
Genomic Location (Zv9):
Chromosome 22 (position 1544006)
Other Location(s):
Assembly Chromosome Position
GRCz10 22 2285096
GRCz11 22 2301362
KASP Assay ID:
554-7659.1 (used for ordering genotyping assays from LGC Genomics)
KASP Sequence:
None
Flanking Sequence:
CATCTTCATCAACACATGCTGATCCACACCGGAGAGAAAACACACAAGTG[T/A]GATCAGTGCAGCAAAATATTTTTGAGAGCTTCAGAGCTGAAGATGCATCT
Associated Phenotype:
Not determined

Register

If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below:

Short-link