
Search Zebrafish Mutation Project
e.g. ENSDARG00000093395 or slc2a11b or ENSG00000135862 or LAMC1 or sa457
You can look for mutant lines by browsing a complete list or by searching for a particular gene
zgc:174224
- Ensembl ID:
- ENSDARG00000071819
- ZFIN IDs:
- ZDB-GENE-050420-147, ZDB-GENE-071004-118
- Description:
- Novel protein [Source:UniProtKB/TrEMBL;Acc:A8DZC1]
Alleles
There are 2 alleles of this gene:
Allele name | Consequence | Status | Availability Estimate |
---|---|---|---|
sa25171 | Nonsense | Mutation detected in F1 DNA | During 2018 |
sa25172 | Nonsense | Mutation detected in F1 DNA | During 2018 |
Mutation Details
- Allele Name:
- sa25171
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- C > T
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000106503 | None | 200 | None | 3 | |
ENSDART00000143499 | Nonsense | 27 | 140 | 2 | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 1543101)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 2284191 GRCz11 22 2300457 - KASP Assay ID:
- 554-7402.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- TTCTCTGTTTGTTCTCCTGAAGCTCTGCCGCCATCAGTGAAAGACAAAGA[C/T]AGAGTTTATTGAAGGACAGTGAGAAGATGAGTGATCCAGAACCCTGCAGA
- Associated Phenotype:
- Not determined
Mutation Details
- Allele Name:
- sa25172
- Current Status:
-
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs. - Availability:
- We currently estimate that this allele will be available during 2018.
- Mutation:
- T > A
- Consequence:
- Nonsense
Transcript ID | Consequence | Amino Acid Affected | Amino Acid Total | Exon Affected | Exon Total |
---|---|---|---|---|---|
ENSDART00000106503 | Nonsense | 144 | 200 | 3 | 3 |
ENSDART00000143499 | None | 140 | 4 | 4 |
- Genomic Location (Zv9):
- Chromosome 22 (position 1544006)
- Other Location(s):
-
Assembly Chromosome Position GRCz10 22 2285096 GRCz11 22 2301362 - KASP Assay ID:
- 554-7659.1 (used for ordering genotyping assays from LGC Genomics)
- KASP Sequence:
- None
- Flanking Sequence:
- CATCTTCATCAACACATGCTGATCCACACCGGAGAGAAAACACACAAGTG[T/A]GATCAGTGCAGCAAAATATTTTTGAGAGCTTCAGAGCTGAAGATGCATCT
- Associated Phenotype:
- Not determined
Register
If you would like to be informed when the status of this gene changes (for example, a new allele is generated or an allele is made available for distribution) then please enter your details below: